Biotolerant materials, Biology

Assignment Help:

Biotolerant materials, are characterized by a thin fibrous tissue interface. The fibrous tissue layer develops as a result of the chemical products from leaching processes, leading to irritation of the surrounding tissues such as Poly(Methyl Methacrylate) acrylic resin. (PMMA).


Related Discussions:- Biotolerant materials

Steps for elongation , a) The elongation level of translation in eukaryo...

a) The elongation level of translation in eukaryotes requires three elongation factors, eEF-IB, eEF-1A and eEF-2, that have similar functions to their prokaryotic counterparts EF-G

Determine the antagonist of the glycine receptor, Person Z swallowed a larg...

Person Z swallowed a large amount of substance X and, as a result, has convulsions (abnormal violent contractions of skeletal muscles).  Swallowing which of the following substance

What do you mean by dengue, Q. What is dengue? The Dengue, or dengue fe...

Q. What is dengue? The Dengue, or dengue fever, is an epidemic disease in some countries (for instance, in Brazil), and its most dangerous form is hemorrhagic dengue. It is cau

How surgical technique affect osseointegration, How Surgical technique affe...

How Surgical technique affect Osseointegration The osteotomy preparation is critical both from biologic and biomechanical points of view. The bone drilling should be sequential

What is peristaltic movement role in human digestion, Q. What are peristalt...

Q. What are peristaltic movements? What is their role in human digestion? Peristalsis is the process of synchronized contractions of the muscular wall of the digestive tube, Pe

Morphological nature of endosperm, Morphological Nature of Endosperm ...

Morphological Nature of Endosperm The morphological nature of endosperm in angiosperms has been a subject of much discussion in evolution. The endosperm in gymnosperms is a g

Why pulses are important for human - nutritional factor, Why Pulses are imp...

Why Pulses are important for human - nutritional factor? Pulses are rich sources of proteins (20-25 g/100 g), the limiting amino acid being methioniize. However, protein quality

What is a phenotype, What is a phenotype? A phenotype is each observabl...

What is a phenotype? A phenotype is each observable characteristic of a living being conditioned by its genes. Some phenotypes may be changed by nongenetic factors (for instanc

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd