Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Bioprosthetic Valves : The risk of thromoboembolism is limited to the first three months, until the sewing ring gets endothelialised. The recommendation is to have less intense regimen of anticoagulation (INR 2-2.5) for all mitral bioprostetic valves. As the incidence of thromoembolism is less for aortic bioprosthesis
anticoagulation is considered to be optional in many centers. They are put on aspirin and persantin. However patients with mitral bioprosthesis who are in AF, who has very large LA and has LA thrombus with history 01 thromboembolism should have long-term low-level anticoagulation.
Why is a leguminous crop rotation used in agriculture? Leguminous crop rotation and other crop rotations are used in agriculture because in these plants many bacteria significa
Q. Which is the extraembryonic membrane whose function is to store nitrogen wastes of the embryo? Is this function present in placental mammalian embryos? The allantois is the
Indifferences in ionic composition Answer A. across membranes can be created through the action of ATP driven pumps as long as number of negative and positive ions on remain equal
Diagnostic Evaluation A study of complete blood count (CBC) and blood chemistry mainly uric acid levels, is necessary for dignostic evaluation. Radiologic studies are
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
what is the prevailing wind direction in equatorial regions affected by the trade winds? a) The wind blows from east to west b) the wind blows from west to east
Flower - Plant Growth Substances Floral initiation is a dramatic event involving a total changeover of the character and developmental pattern of the meristem. The stimulus ca
Why Diabetics patient should have Vegetables every day Diabetics should have vegetables every day. Fresh vegetables are to be preferred because they have less fats and salt. Da
Explain the Physical Methods to Control Microorganisms? The physical methods to control microorganisms involve heat, filtration or radiations. Figure illustrates these methods.
Enumerate the different means of evaluating the implant prior to stage 2 surgery. The Different means for evaluating the implant prior to stage 2; i) Radiographic evaluation
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd