biological conservation, Biology

Assignment Help:
what are the significance of zoological parks in conversation

Related Discussions:- biological conservation

Absorption of lipids, what are lipids? how ther absorption takes place in h...

what are lipids? how ther absorption takes place in human bodies?

Free racials, Which of the following could potentially be a free radical? A...

Which of the following could potentially be a free radical? Answer oxygen (atomic number 8) helium (atomic number 2) neon (atomic number 10)

Calculate the electric potential at the midpoint of the base, The three cha...

The three charges in the figure below are at the vertices of an isosceles triangle. Let q = 7.00 nC and calculate the electric potential at the midpoint of the base.

Procedures for diagnosis - demonstration of specific antigen, Demonstration...

Demonstration of specific antigen(s): The presence of the viral antigen in the infected tissues and cells can be demonstrated by fluorescent antibody technique (FAT) and

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Protein synthesis, Protein Synthesis The central dogma of modern bioche...

Protein Synthesis The central dogma of modern biochemistry is totally based on the coded information holds within deoxyribonucleic acid (DNA). Double stranded DNA is converted

Explain fossn ovalis defect ostium secundum defect, Explain Fossn Ovalis De...

Explain Fossn Ovalis Defect (Ostium Secundum Defect) ? This is the most common type of atrial septal defect. The usual approach is through a midline incision and median sterno

Explain the largest group of bacteria eubacteria, Explain the largest group...

Explain the largest group of bacteria Eubacteria? Eubacteria are the largest group of bacteria within Kingdom Monera. They are the "true" bacteria, what most people referred to

Advantage & disadvantage of using fungi as source of protein, Define Advant...

Define Advantage & disadvantage of using fungi as source of protein? Advantages 1. Easy to harvest from culture medium. 2. Texture of the fungi improves the functional

What is the major biological function of ribosomes, Q Where in the cell can...

Q Where in the cell can ribosomes be found? What is the major biological function of ribosomes? Ribosomes can be found free in the cytoplasm, adhered to the external side of th

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd