Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Long Distance Transport Once in the xylem vessels, the transport of the mineral elements from the root to the shoot is driven by the gradient of hydrostatic pressure (root pre
how trematodes/nematodes adapt to their parasitic mode of feeding
REGUL A TIV E THEORY It was propounded by Hens Driesch. He performed experiments on the eggs of sea urchin similar to the experiments performed by Roux. He observed
What is Prokaryotic Gene Expression ? Control of prokaryotic gene expression occurs primarily at the level of transcription. Prokaryotic genes are arranged in units consisting
How is it explained that a person with the spinal cord sectioned at the cervical level is still able to perform the patellar reflex? The arch reflex depends only on the integr
Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4
Low levels of dissolved salts characterise the freshwater biomes. The salt content of fresh water is about 0.005 percent. The freshwater biomes consist of inland bodies of standing
How is L. monoctogenes infection transmitted? Listriosis caused by Listeria monocytogenes infection. Transmitted by animal excretions (faecal matter) and secretions, infecte
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Explain Pro-Oxidants Transition metals, particularly those possessing two or more valency states and a suitable oxidation - reduction potential between them (e.g., cobalt, cop
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd