biological collections, Biology

Assignment Help:
Why do scientists make biological collections? What are the scientific reasons for doing a collection? How is a collection done?

Related Discussions:- biological collections

Define kingdom monera and protista?, Q. Which are the beings that constitut...

Q. Which are the beings that constitute the kingdom Monera? The kingdom Monera is the kingdom of the prokaryotes, archaebacteria and composed of bacteria. Q. Which are the

Phylum, description of first five phylum

description of first five phylum

Determine the synaptic process, Since neurotransmitters are not consumed in...

Since neurotransmitters are not consumed in the synaptic process, what are the mechanisms to decrease their concentrations in the synaptic cleft after they have been used? As t

Assessment of megaloblastic anaemia, Assessment   On observation of a c...

Assessment   On observation of a child with this type of anaemia you will find that in addition to the symptoms  of iron deficiency anaemia there is hyper-pigmentation over knu

Define dietary factors with antinutritional effects, Define Dietary Factors...

Define Dietary Factors with Antinutritional Effects? In the above sections, we have learnt about a variety of food components having a host of health promotive properties. Let

Excretion, what is the excretory organ of agama lizard

what is the excretory organ of agama lizard

Carrier protein in a plasma membrane, What is a characteristic feature of a...

What is a characteristic feature of a carrier protein in a plasma membrane? Carrier proteins are globular proteins which are particular it their action and therefore regulate t

Explain the nerve cell structure and function, Explain the Nerve Cell Struc...

Explain the Nerve Cell Structure and Function? Before studying the organization of the nervous system, we will look at the relationship between structure and function of nerve

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd