Biodiversity maintains, Biology

Assignment Help:

Biodiversity maintains the air we breathe and the water we drink. Green plants purify our air and our water by taking in carbon dioxide, regulating water vapour, releasing oxygen, and cycling nutrients. Through photosynthesis, trees and other plants give off oxygen that helps maintain atmosphere. As a result of these processes, plants play a crucial role in maintaining the planet's water cycle. Wetlands and the vast array of bacteria and other microscopic species they house also act as water filters.

The activities of microbial and animal species - including bacteria, algae, fungi, mites, millipedes and worms - condition soils, bring organic matter, and release essential nutrients to plants. These processes play a key role in the cycling of such crucial elements e.g. nitrogen, carbon and phosphorous between the living and non -living parts of the biosphere.

Wetland ecosystems (swamps, marshes, etc.) absorb and recycle essential nutrients, treat sewage, and cleanse wastes. In estuaries molluscs remove nutrients from the water, helping to prevent over-enrichment and its attendant problems, such as eutrophication arising from fertilizer run-off. Trees and forest soils purify water that flows through forest ecosystems. In preventing soils from being washed away, soil protection by forests also prevent the harmful siltation of rivers from erosion and landsli des.


Related Discussions:- Biodiversity maintains

Explain about pentoses, What are pentoses? To what organic group do pentose...

What are pentoses? To what organic group do pentoses belong? Are nucleotides formed of only one type of pentose? Pentoses are carbohydrates made of five carbons. Deoxyribose is

Explain fundamental of the photosynthesis process, Q. Is it correct to cons...

Q. Is it correct to consider water decomposition by the action of light the fundamental of the photosynthesis process? In addition ADP photophosphorylation, photic energy is al

Gumbout chiton, what is the classification of the Gumbout Chiton?

what is the classification of the Gumbout Chiton?

Energy yield of citric acid cycle , Each of the three NADH molecules formed...

Each of the three NADH molecules formed per turn of the cycle yields 3 ATPs and the one FADH2 yields 2 ATPs by oxidative phosphorylation (whereas some measurements indicate in whic

What is the condition for mendels second law to be valid, What is the condi...

What is the condition for Mendel's second law to be valid? Mendel's second law is only valid for genes located in dissimilar chromosomes. For genes situated in the same chromos

Precaution for estimate the cholesterol using zlatkis method, Define Precau...

Define Precautions for Estimation of Cholesterol Using Zlatkis Method 1. Use aldehyde free glacial acetic acid. 2. Use only glacial acetic for making up and adjusting the vo

Plot the amount of dna in the nucleus, Plot the amount of DNA in the nucleu...

Plot the amount of DNA in the nucleus of spermatogonia from the G1 stage prior to the first meiotic division through the completion of meiosis. Label each of the major stages of th

Differences between anastral and astral mitosis, Q. What are the difference...

Q. What are the differences between anastral and astral mitosis? Astral mitosis is that in which there is formation of the aster a structure made by the centrioles. Anastral mi

What is the indication of chronic pulmonary thromboembolism, Chronic Pulmon...

Chronic Pulmonary Thromboembolism :  The operation recommended is pulmonary thrombo endarterectomy. Indication :  The main indication for surgery is when patients with chroni

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd