biodiversity, Biology

Assignment Help:
importance of biodevercity

Related Discussions:- biodiversity

What is guided bone regeneration, What is Guided bone regeneration Gui...

What is Guided bone regeneration Guided bone regeneration (GBR) allow the practitioner to place implants in patients who would not have received this treatment option a few y

Define significance of plants and animals on human life, Define Significanc...

Define Significance and Impact of Plants and Animals on Human Life? Plants and animals both have a great significance and unparalleled impact on human life. Most of our needs a

Water - properties and functions, W A TER Occurence Water is ...

W A TER Occurence Water is the most abundant substance, covering 70% of earth's surface. It constitutes 60-90% of living cells.              5-6% in tooth e

Give source organism of the dna polymerase used in pcr, a) Mention the numb...

a) Mention the number of primers needed in each cycle of polymerase chain Reaction (PCR) . Write the role of primers and DNA polymerase in PCR. b) Give the characteristic fea

What is pus, What is pus Pus is a residual of the inflammatory reaction...

What is pus Pus is a residual of the inflammatory reaction. It is having a mixture of fragments of dead leukocytes, infectious agents (generally bacteria) and tissues.

What is the nitrogen cycle, What is the nitrogen cycle? The nitrogen cy...

What is the nitrogen cycle? The nitrogen cycle represents the circulation and recycling of the chemical element nitrogen in nature. The nitrogen cycle basically depends on t

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Prognosis, The course and ultimate prognosis of ARF is usually directly rel...

The course and ultimate prognosis of ARF is usually directly related to the severity of carditis. The course and prognosis also depends upon recurrence of rheumatic fever. In pre-p

Factors affecting water requirements of microorganisms, Q. Factors Affectin...

Q. Factors Affecting Water requirements of microorganisms? Factors that may affect aw requirements of microorganisms include: 1. Kind of solute employed to reduce the aw: F

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd