Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
What is Guided bone regeneration Guided bone regeneration (GBR) allow the practitioner to place implants in patients who would not have received this treatment option a few y
Define Significance and Impact of Plants and Animals on Human Life? Plants and animals both have a great significance and unparalleled impact on human life. Most of our needs a
why does animals respire??
W A TER Occurence Water is the most abundant substance, covering 70% of earth's surface. It constitutes 60-90% of living cells. 5-6% in tooth e
a) Mention the number of primers needed in each cycle of polymerase chain Reaction (PCR) . Write the role of primers and DNA polymerase in PCR. b) Give the characteristic fea
What is pus Pus is a residual of the inflammatory reaction. It is having a mixture of fragments of dead leukocytes, infectious agents (generally bacteria) and tissues.
What is the nitrogen cycle? The nitrogen cycle represents the circulation and recycling of the chemical element nitrogen in nature. The nitrogen cycle basically depends on t
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
The course and ultimate prognosis of ARF is usually directly related to the severity of carditis. The course and prognosis also depends upon recurrence of rheumatic fever. In pre-p
Q. Factors Affecting Water requirements of microorganisms? Factors that may affect aw requirements of microorganisms include: 1. Kind of solute employed to reduce the aw: F
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd