Biochemical production , Biology

Assignment Help:

Biochemical Production:

Plants are the foundation of a large variety of biochemical which are metabolites of both secondary and primary metabolism. But secondary metabolites are of much larger interest since they have remarkable biological activities like antibiotic, antimicrobial, molluscidal, insecticidal, hormonal properties, and pharmaceutical activities and valuable pharmacological, and various are used as flavours, colours, fragrances etc. The part secondary metabolite is ill-described but convenient, it is operated to all those compounds which are not directly added in the primary metabolic processes, e.g. photosynthesis, respiration, lipid biosynthesis and protein etc. Secondary metabolites add a wide variety of elements, e.g. terpenoids, alkaloids, phenyl propanoids.

 


Related Discussions:- Biochemical production

Determine the carbon based materials, Carbon Based Materials These incl...

Carbon Based Materials These include Pyrolytic carbon, polycrystalline (Vitreous Carbon), and carbon/silicon interstitial combination. Vitreous Carbon -Solid or porous vitre

Principles of haccp, Principles of HACCP A) Determine the  Critical  Co...

Principles of HACCP A) Determine the  Critical  Control  Points  (CCPs) B) Establish  Critical Limit(s) C) Establish a  System  to  Monitor Control of the  CCP D) Esta

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Introduction to heart surgery, INTRODUCTION :  It took just hundred years ...

INTRODUCTION :  It took just hundred years for cardiac surgery to advance to what it is today. Before 1896, surgeons considered heart to be "inviolable" and it was stated that ope

Blackquarter, B l ac k q u ar t e r The disease is otherwise k...

B l ac k q u ar t e r The disease is otherwise known as black leg or emphysematous gangrene, and it is associated with severe toxaemia, emphysematous swelling of muscl

Interaction of pyridoxine with ascorbic acid and leucine, Define Interactio...

Define Interaction of pyridoxine with Ascorbic acid and Leucine? Ascorbic acid: Vitamin B 6 metabolism increases with. Higher levels of vitamin C intake. Whole blood a

Show the process of construction of keys, Q. Show the process of Constructi...

Q. Show the process of Construction of Keys? Keys are constructed using contrasting characters. The possible names in the key are divided into smaller and smaller groups. Each

How would you perform abo blood grouping, Question 1 How would you perform...

Question 1 How would you perform ABO blood grouping? Add a note on advantages and disadvantages of each method. Also discuss the precautions you may take to avoid errors in variou

Illustarte the utilization of soy protein concentrate, Utilization of Soy P...

Utilization of Soy Protein Concentrate Soy protein concentrates are used in food products for  their nutritional characteristics or for their functional properties or for both.

What is tyrosinemia, Q. What is Tyrosinemia? There are two forms of her...

Q. What is Tyrosinemia? There are two forms of hereditary tyrosinemia. They are tyrosinemia Type I and tyrosinemia Type II. Type I was thought to be due to a deficiency of para

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd