Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Biochemical Changes
Many workers have tried to follow the biochemical changes that precede flowering and result in meristems which give rise to flowers instead of vegetative structures. In Pharbitis, which is a short-day plant and requires only one dark period for flowering it was found that soon after the dark period, the flowering stimulus begins to move out of the leaves. In this experiment, the plant was given inductive conditions and after specific time intervals, biochemical changes were measured in meristems. An increase in metabolic activity around 40th hour at the floral apex was manifested by an increase in the level of RNA, proteins and ribosomes. Electron microscopic observations also revealed extensive formation of endoplasmic reticulum.
These activities were followed by an increase in DNA synthesis and mitotic activity. At about 88th hour after floral induction, the rate of cell division increased at apical and axillary meristems and the increase in cell division was noticed particularly in the central zone and peripheral zones of apical meristems. Such experiments have also been done in other plants. However, it has not been possible yet to identify which of the RNA or proteins are responsible for the onset of flowering. With the application of newer techniques it has been possible to suggest that there are some specific flowering genes which get switch on after receiving specific light-dark cycle. Although we do not know the products of all these genes, some of them have been shown to code for proteins which regulate transcription.
"Diversity is good" is one of the axioms of conservation biology. However in absentia of historical information, why is noting higher diversity in a system NOT the best way to eval
Q. What is Parkinson's disease? The Parkinson's disease is a degenerative disease of the nervous system in which the major manifestations are progressive motor disturbances, li
E r y s i p e l a s A sudden onset of infection with the bacterium E rysipelothrix insidiosa ( E . rhusiopathiae ) is seen in turkeys and increasingly in free-rang
Define the Spray Drying Method? Spray drying is a unique drying process since it involves both particle formation and drying. It is most suitable for drying of liquid foods suc
1) What are some characteristics that define the lifestyle of a parasitic nematode? 2) What are beneficial nematodes? Discuss their significance
Ac ute heart failure The acute heart failure is characterized by sudden loss of consciousness and falling with or without convulsions. The mucous membranes become pale followe
Q. Why is the digestive system of these animals called incomplete? Incomplete digestive system is in that which the digestive cavity has only one opening.
What is Computerised tomography Computerised tomography (CT, but also known as computerised axial tomography, or CAT) provides structural images. To generate brain scans, low l
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. International Codes used for system of binomial nomenclature? In 1753 Linnaeus suggested a system of binomial nomenclature where each individual is denoted by two epithets,
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd