Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Bi-Parental Reproduction
In sexually reproducing metazoans, there are separate and distinct male and female individuals. Each has its own reproductive system and produces one kid of sex cell, spermatozoon or egg. Nearly all vertebrates and many invertebrates have separate sexes, and such a condition is celled dioecious and this type of reproduction is called biparental reproduction. However, some animals such as most flatworms, some hydroids, annelids, crustaceans and some fishes have both male and female organs in the same individual. Such a condition is called hermaphroditism. In contrast to the dioecious state of separate sexes, hermaphrodites are monoecious, having both male and female organs in the same organism Most of the hermaphrodites avoid self-fertilization by exchanging germ cells with each other.
For example, although the earthworm bears both male and female organs, its eggs are fertilised by the copulating male and vice versa. Hermaphrodites also prevent self-fertilisation by developing eggs and sperms at different times. If we admit that all living things are mortal, that every living organism is endowed with a life span that must eventually end, then reproduction is indispensable for the continuance of species. During evolution the efficiency of reproduction increased where the parents protect and provide nutrition for the young before or after birth. The adaptations that are found in vertebrates are internal fertilisation, the cleidoic (enclosed in shell) egg, and the foetal membranes. Parallel adaptations are also found in lower animals.
Determine about the term - Copper Copper is known to act as an electron carrier in enzymes which bring about oxidation - reduction and regulates respiratory activity in plant
Question 1: Describe the need for Harmonization in clinical trials? Brief on the Revised ICH terms of reference and explain the structure of ICH? Need for Harmonization i
Q. What is the neuromuscular synapse? Neuromuscular synapse is the structure through which the neural impulse passes from the axon of a motor neuron to the muscle cell. This st
Define The figure of 8 and Mattress suturing techniques The figure of 8: is placed similarly to the simple loop on the buccal aspect; however, on the lingual aspect, the needl
R a d i o g r a p h y: Radiograph or X-ray remains the most well-known and primary diagnostic tool of all the imaging modalities. It works b
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Human Development Human development is a continuous procedure that begins when the ovum from a female is fertilised via sperm from a male to form the zygote. Growth and differ
Congenital Discrete Subvalver Stenosis : The abstraction could be fibrous or fibro muscular. It could be anywhere from just below the aortic cusps upto the level of the free edge
Q. Show the Natural selection of taxonomist? Natural selection associated with successful reproduction maintains a basic similarity of the reproductive feature of flowers, frui
Post removal Types of post : -Active threaded -Passive -Custom casted Cement used : -Traditional cement -bonded with a composite resin -Dentin-bonding agent -Pro
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd