Bi-parental reproduction, Biology

Assignment Help:

Bi-Parental Reproduction

In sexually reproducing metazoans, there are separate and distinct male and female individuals. Each has its own reproductive system and produces one kid of sex cell, spermatozoon or egg. Nearly all vertebrates and many invertebrates have separate sexes, and such a condition is celled dioecious and this type of reproduction is called biparental reproduction. However, some animals such as most flatworms, some hydroids, annelids, crustaceans and some fishes have both male and female organs in the same individual. Such a condition is called hermaphroditism. In contrast to the dioecious state of separate sexes, hermaphrodites are monoecious, having both male and female organs in the same organism Most of the hermaphrodites avoid self-fertilization by exchanging germ cells with each other.

For example, although the earthworm bears both male and female organs, its eggs are fertilised by the copulating male and vice versa. Hermaphrodites also prevent self-fertilisation by developing eggs and sperms at different times. If we admit that all living things are mortal, that every living organism is endowed with a life span that must eventually end, then reproduction is indispensable for the continuance of species. During evolution the efficiency of reproduction increased where the parents protect and provide nutrition for the young before or after birth. The adaptations that are found in vertebrates are internal fertilisation, the cleidoic (enclosed in shell) egg, and the foetal membranes. Parallel adaptations are also found in lower animals.


Related Discussions:- Bi-parental reproduction

Explain the use of benzoates acid, Q. Explain the use of Benzoates acid? ...

Q. Explain the use of Benzoates acid? Benzoic acid, sodium benzoate and the parahydroxy esters (parabens) are used as preservatives. Benzoic acid and its sodium salt, sodium be

What is hyperhomocysteinaemia, What is Hyperhomocysteinaemia ? Homocyst...

What is Hyperhomocysteinaemia ? Homocysteine has been considered as a risk factor for Cardio-vascular diseases because of many epidemiological and observational studies showing

What is name for interruptions for myelin sheath, In most axons, myelin she...

In most axons, myelin sheath is interrupted at intervals of about 1 millimeter or more. These interruptions are known as: a) Collaterals b) Nodes of Ranvier (pron: ron-vee-ay)

Types of regeneration, TYPES OF REGENERATION - R eparativ...

TYPES OF REGENERATION - R eparative R estorative 1. It is limited to healing of wounds or replacement of cells It can replace

Draw a class diagram, Draw a class diagram: You are required to provid...

Draw a class diagram: You are required to provide a practical implementation in C++ for the following class diagram. You have to provide the solution in the form of classes in

Determine the biologic response, Determine the biologic response The bi...

Determine the biologic response The biologic response can include: i) Metabolic disturbance. ii) Inflammatory response iii) Immune response iv) Mutagenesis v) Ca

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Pollen biology, Pollen Biology Fluorescence microscopy coupled with bi...

Pollen Biology Fluorescence microscopy coupled with biochemical analysis has helped resolve the differential activity of the enzyme, β-l, 3- glucanase that catalyses the disso

Trends in human evolution, Before we further proceed to discuss the fossil ...

Before we further proceed to discuss the fossil history of the humans we shall briefly look into what distinguishes humans or genus Homo from his ancestors namely the apes. These d

Observing the development of flowers into fruit, Observing the development ...

Observing the development of flowers into fruit Collect specimens of flowers in dissimilar stages of maturity from newly opened buds to specimens in which the petals have falle

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd