Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Echocardiography is one of the -most frequently used imaging modalities for diagnosing cardiovascular diseases. It i's versatile and is applicable in the entire spectrum of cardiovascular disease, so much so that now it is considered an extension of the physical examination. It is non-invasive, portable and can be utilized in sick patients, in emergency room or in the walk in symptomatic patients with mitral stenosis or in a young asymptomatic individual with a murmur on routine physical examination. If performed adequately by a skilled operator it can be used as a definitive rather than a screening diagnostic tool. So knowledge about Echocardiography is essential for every physician dealing with cardiovascular diseases.
Explain Properties of Natural fats and oils Natural fats and oils vary widely in their physical properties even though they are composed of the same or similar fatty acids. Th
Q. Etiological factor of malabsorption syndrome? The causes cited for malabsorption can be associated with a number of diseases. Many of these diseases you may not know presen
Explain assessment of iron status - Serum Ferritin? Serum Ferritin: This method is indicative of iron stores. As we know, a long term negative iron balance first results in dep
Explain the Economics in Nutrition? We mentioned earlier that nutritional problems affect the productivity of the individual, which, in turn affects the productivity of the nat
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
WHAT IS THE FUNCTION OF CELL COAT
Q. Can you show Downsloping ST-Segment? The long term follow-up information suggests that patients whose ST depression evolves to downsloping have more severe disease than tho
Q. How to investigate aortic stenosis by Electrocardiogram? Typically left ventricular hypertrophy with strain pattern is seen in severe aortic stenosis. Total QRS amplitude in
Events after Sperm and Egg Fusion The entry of the sperm into the egg activates the egg. The activation of egg results in two types of responses. (1) The early responses a
Availability of nutrients in soils The productivity of a crop depends largely on the nutrients discussed in the previous section. It is important to find out methods which wil
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +1-415-670-9521
Phone: +1-415-670-9521
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd