Basics of echocardiography, Biology

Assignment Help:

Echocardiography is one of the -most frequently used imaging modalities for diagnosing cardiovascular diseases. It i's versatile and is applicable in the entire spectrum of cardiovascular disease, so much so that now it is considered an extension of the physical examination. It is non-invasive, portable and can be utilized in sick patients, in emergency room or in the walk in symptomatic patients with mitral stenosis or in a young asymptomatic individual with a murmur on routine physical examination. If performed adequately by a skilled operator it can be used as a definitive rather than a screening diagnostic tool. So knowledge about Echocardiography is essential for every physician dealing with cardiovascular diseases.


Related Discussions:- Basics of echocardiography

Explain properties of natural fats and oils, Explain Properties of Natural ...

Explain Properties of Natural fats and oils Natural fats and oils vary widely in their physical properties even though they are composed of the same or similar fatty acids. Th

Etiological factor of malabsorption syndrome, Q. Etiological factor of mala...

Q. Etiological factor of malabsorption syndrome? The causes cited for malabsorption can be associated with a number of diseases. Many of these diseases you may not know presen

Explain assessment of iron status - serum ferritin, Explain assessment of i...

Explain assessment of iron status - Serum Ferritin? Serum Ferritin: This method is indicative of iron stores. As we know, a long term negative iron balance first results in dep

Explain the economics in nutrition, Explain the Economics in Nutrition? ...

Explain the Economics in Nutrition? We mentioned earlier that nutritional problems affect the productivity of the individual, which, in turn affects the productivity of the nat

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

#title, WHAT IS THE FUNCTION OF CELL COAT

WHAT IS THE FUNCTION OF CELL COAT

Can you show downsloping st-segment, Q. Can you show Downsloping ST-Segment...

Q. Can you show Downsloping ST-Segment? The long term follow-up information suggests that patients whose ST depression evolves to downsloping have more severe disease than tho

How to investigate aortic stenosis by electrocardiogram, Q. How to investig...

Q. How to investigate aortic stenosis by Electrocardiogram? Typically left ventricular hypertrophy with strain pattern is seen in severe aortic stenosis. Total QRS amplitude in

Events after sperm and egg fusion, Events after Sperm and Egg Fusion ...

Events after Sperm and Egg Fusion The entry of the sperm into the egg activates the egg. The activation of egg results in two types of responses. (1) The early responses a

What is available soil nutrient, Availability of nutrients in soils  Th...

Availability of nutrients in soils  The productivity of a crop depends largely on the nutrients discussed in the previous section. It is important to find out methods which wil

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd