Bacillus thirungiensis, Biology

Assignment Help:
What are the genes responsible for the toxic substance in bt?

Related Discussions:- Bacillus thirungiensis

Explain the factors affecting the process of deep fat frying, Factors affec...

Factors affecting the process of deep fat frying. The common factors influencing the process of deep frying include: 1.  Heat- Frying temperatures ranging from 150 -190°C

Define principle behind the functioning of a ph meter, Define Principle beh...

Define Principle behind the functioning of a pH meter? Principle Hydrogen ions in solution, like other ionic species, conduct an electric current. When a glass electrode is dip

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Traditional meat products, Tr aditional Meat Products The rich heritag...

Tr aditional Meat Products The rich heritage of India contributes to wide range of traditional foods and has a role to play in health foods. Indigenous meat products are uniqu

Psychological disorders, PSYCHOLOGICAL DISORDERS - 1 .       Anxiety ...

PSYCHOLOGICAL DISORDERS - 1 .       Anxiety Disorders 2 .       Obsessive compulsive disorders 3.       Attention deficit disorder 4 .       Mood disorders

Darwins theory of natural selection, Darwins theory of natural selection is...

Darwins theory of natural selection is considered a paradigm shift--a theory that has wide-ranging effects. Describe some of the advantages that this theory offered scientists once

What is cilia and flagella, What is Cilia and Flagella? The surfaces of...

What is Cilia and Flagella? The surfaces of many eukaryotic cells bear cilia or flagella, built from specialized microtubules. Cilia are tiny brushlike hairs, and flagella are

Determine some methods of blood glucose estimation, Determine some Methods ...

Determine some Methods of Blood Glucose Estimation? The various types of methods for estimation of blood glucose can be grouped under two groups: a) Chemical methods b) E

What type of colour blindness is most common in men, What type of colour bl...

What type of colour blindness is most common in men? Red-green colour blindness is the most regular form of colour blindness in men.

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd