Availability of adp, Biology

Assignment Help:

Availability of ADP

When  the ADP  levels increase due to hydrolysis ofATP  in various biosynthetic reactions,  the  rate of reaction to generate ATP  is accelerated and this is mainly by oxidative phosphorylation. There are 4 reactions in which  the reducing equivalents are transported to respiratory chain coupled with the generation ofATP in this cycle and thus increase in ADP causes oxidation of acetyl CoA by the citric acid cycle.

 


Related Discussions:- Availability of adp

What is the spontaneous generation hypothesis, What is the spontaneous gene...

What is the spontaneous generation hypothesis? The spontaneous generation hypothesys, or abiogenesis, asserts that life on earth has come from nonliving material. For instance,

Food-borne clostridium, Food-borne Clostridium Clostridium botulinum a...

Food-borne Clostridium Clostridium botulinum and Cl. perfringens, the two members of the group have been implicated in food-borne illnesses. C. botulinum causes classical food

Discuss the evolution of implants in dentistry, Q. Discuss the evolution of...

Q. Discuss the evolution of implants in dentistry? The first use of Implants dates back to 600 A.D. in the Mayan population where intraosseous implantation of animal teeth or t

Inferior epigastric artery-other arterial conduits, Inferior Epigastric Art...

Inferior Epigastric Artery (I.) :  This is a branch of external iliac artery supplying the abdominal wall. It is raised as a free graft for CABG. The usual length availab

State the amount of micronutrients in fertilizers, State the amount of micr...

State the amount of micronutrients in fertilizers The amount of micronutrients in fertilizers must be much more carefully controlled than the macronutrients. The difference be

Abscisic acid, Abscisic Acid Abscisic acid (ABA) as a naturally occurr...

Abscisic Acid Abscisic acid (ABA) as a naturally occurring growth inhibitor was discovered through independent investigations of different physiological phenomena in two diffe

Silent myocardial ischaemia, Q. Silent Myocardial Ischaemia? Ans. ...

Q. Silent Myocardial Ischaemia? Ans. This deals primarily with those who have never had symptoms recognized as being of cardiac origin. Others, who have had recognized myo

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Mode of hormone action through intracellular receptors, MOD E OF HORMONE A...

MOD E OF HORMONE ACTION THROUGH INTRACELLULAR RECEPTORS - Steroid hormones are lipid-soluble and easily pass through the cell membrane of a target cell into the cytoplasm.

Photosynthesis carbon dioxide, Q. Why is it said that during photosynthesis...

Q. Why is it said that during photosynthesis carbon dioxide is improved to form glucose? During photosynthesis carbon dioxide is energetically improve with hydrogen from water.

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd