Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Availability of ADP
When the ADP levels increase due to hydrolysis ofATP in various biosynthetic reactions, the rate of reaction to generate ATP is accelerated and this is mainly by oxidative phosphorylation. There are 4 reactions in which the reducing equivalents are transported to respiratory chain coupled with the generation ofATP in this cycle and thus increase in ADP causes oxidation of acetyl CoA by the citric acid cycle.
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
An ecosystem consists of two types of components: (a) Abiotic components: This includes the non-living components of the ecosystem. These are physical and chemical fact
Which cell count is likely to be elevated when an individual has an allergy or parasitic worms? a) Red blood cells b) Erythrocyte c) Eosinophil (pron: e-o-sin-o-fill)
name the sturcture formed when the male and female nuclei fuse during fertilisation.
what is persons subunit
Effects of long term malnutrition The effects of long term malnutrition are more severe in children. Children do not have sufficient amounts of carbohydrates and fats in
Explain the Population Growth? A population can grow, it can remain stable, or it can decrease in size. Measuring the size of a population over time is used to help determine t
History Past and present history of cardiovascular problems of patient & family. History of chest pain, shortness of breath, fatigue, abnormal skin colour, dizziness, vertigo
what is the chemical reaction of respiration in cockroach?
What is a biodigester? A biodigester is equipment that creates carbon dioxide, hydrogen sulfide and fuel gases (biogases) like methane from organic material under decomposition
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd