Availability of adp, Biology

Assignment Help:

Availability of ADP

When  the ADP  levels increase due to hydrolysis ofATP  in various biosynthetic reactions,  the  rate of reaction to generate ATP  is accelerated and this is mainly by oxidative phosphorylation. There are 4 reactions in which  the reducing equivalents are transported to respiratory chain coupled with the generation ofATP in this cycle and thus increase in ADP causes oxidation of acetyl CoA by the citric acid cycle.

 


Related Discussions:- Availability of adp

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Components of ecosystem, An ecosystem consists of two types of components: ...

An ecosystem consists of two types of components: (a)   Abiotic components: This includes the non-living components of the ecosystem. These are physical and chemical fact

Which cell count elevates in case of allergy or plastic worm, Which cell co...

Which cell count is likely to be elevated when an individual has an allergy or parasitic worms? a) Red blood cells b) Erythrocyte c) Eosinophil (pron: e-o-sin-o-fill)

Reproduction, name the sturcture formed when the male and female nuclei fus...

name the sturcture formed when the male and female nuclei fuse during fertilisation.

Effects of long term malnutrition, Effects of long term malnutrition ...

Effects of long term malnutrition The effects of long term malnutrition are more severe in children. Children do not have sufficient amounts of carbohydrates and fats in

Explain the population growth of ecology, Explain the Population Growth? ...

Explain the Population Growth? A population can grow, it can remain stable, or it can decrease in size. Measuring the size of a population over time is used to help determine t

History - assessment of patents with cardiovascular probems, History P...

History Past and present history of cardiovascular problems of patient & family. History of chest pain, shortness of breath, fatigue, abnormal skin colour, dizziness, vertigo

Respiration in cockroach, what is the chemical reaction of respiration in c...

what is the chemical reaction of respiration in cockroach?

What is a biodigester, What is a biodigester? A biodigester is equipmen...

What is a biodigester? A biodigester is equipment that creates carbon dioxide, hydrogen sulfide and fuel gases (biogases) like methane from organic material under decomposition

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd