Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Availability of ADP
When the ADP levels increase due to hydrolysis ofATP in various biosynthetic reactions, the rate of reaction to generate ATP is accelerated and this is mainly by oxidative phosphorylation. There are 4 reactions in which the reducing equivalents are transported to respiratory chain coupled with the generation ofATP in this cycle and thus increase in ADP causes oxidation of acetyl CoA by the citric acid cycle.
What is the spontaneous generation hypothesis? The spontaneous generation hypothesys, or abiogenesis, asserts that life on earth has come from nonliving material. For instance,
Food-borne Clostridium Clostridium botulinum and Cl. perfringens, the two members of the group have been implicated in food-borne illnesses. C. botulinum causes classical food
Q. Discuss the evolution of implants in dentistry? The first use of Implants dates back to 600 A.D. in the Mayan population where intraosseous implantation of animal teeth or t
Inferior Epigastric Artery (I.) : This is a branch of external iliac artery supplying the abdominal wall. It is raised as a free graft for CABG. The usual length availab
State the amount of micronutrients in fertilizers The amount of micronutrients in fertilizers must be much more carefully controlled than the macronutrients. The difference be
Abscisic Acid Abscisic acid (ABA) as a naturally occurring growth inhibitor was discovered through independent investigations of different physiological phenomena in two diffe
Q. Silent Myocardial Ischaemia? Ans. This deals primarily with those who have never had symptoms recognized as being of cardiac origin. Others, who have had recognized myo
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
MOD E OF HORMONE ACTION THROUGH INTRACELLULAR RECEPTORS - Steroid hormones are lipid-soluble and easily pass through the cell membrane of a target cell into the cytoplasm.
Q. Why is it said that during photosynthesis carbon dioxide is improved to form glucose? During photosynthesis carbon dioxide is energetically improve with hydrogen from water.
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd