Auxiliary food chains, Biology

Assignment Help:

Auxiliary Food Chains

In addition to grazing and detritus food chains there are other auxiliary food chains operated through parasites and scavengers. Some parasitic food chains may be quite complex and may involve unrelated organisms. A deer fed upon by internal roundworms and external ticks or a man with malarial parasites in his blood are examples of parasitic food chains. Often, parasitic relations are quite involved as parasites are transmitted through a variety of vectors or through unrelated intermediary host organisms. Like the other food chains, the ultimate source of energy for all auxiliary food chains is, solar energy originally harvested by plants.


Related Discussions:- Auxiliary food chains

Explain the term- horizons, Explain the term- Horizons These processes ...

Explain the term- Horizons These processes take a long time- may be a few thousand years to create a soil. As the time passes, the soil matures and generally becomes deeper and

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Decomposers - biotic components, Decomposers - Biotic Components Also ...

Decomposers - Biotic Components Also known as saprotrophs. Mostly, these are microscopic and are heterotrophic in nature. Decomposer organisms obtain their energy and nutrient

Define tubular-dorsal nervous system, Q. How can the tubular-dorsal nervous...

Q. How can the tubular-dorsal nervous system in chordates be compared to the nervous pattern present in invertebrates? In chordates the nervous system is dorsal and highly ceph

What is right patellar tendon, What is right patellar tendon Which of t...

What is right patellar tendon Which of the following occur in response to an increase in the length of the right knee extensors in response to a quick tap applied to the right

Photosynthesis, Photosynthesis Photosynthesis - the process by which p...

Photosynthesis Photosynthesis - the process by which plants utilise energy from sunlight to convert carbon dioxide and water for the synthesis of sugar. This sugar can then be

What is the permeability to sodium ions, An impermeable membrane separates ...

An impermeable membrane separates a one liter solution of 1M NaCl in the left compartment from a one liter solution of 2M KCl in the right compartment.  At 2 AM the membrane became

Biochemical production, Plants are the source of a large variety of bioche...

Plants are the source of a large variety of biochemicals which are metabolites of both primary and secondary metabolism. But secondary metabolites are of much greater interest s

Synthesis of citratefrom acetyl coa and oxaloacetate, Synthesis of citratef...

Synthesis of citratefrom acetyl CoA and oxaloacetate: Citrate synthase catalyses this aldol condensation reaction with the release of CoA. There are certain inhibitors to  this re

Incompatibility - pollination and fertilization, Incompatibility - Pollinat...

Incompatibility - Pollination and Fertilization Plants growing under natural conditions have a preference for their mating partners. The stigma of the female parent receives a

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd