Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Auxiliary Food Chains
In addition to grazing and detritus food chains there are other auxiliary food chains operated through parasites and scavengers. Some parasitic food chains may be quite complex and may involve unrelated organisms. A deer fed upon by internal roundworms and external ticks or a man with malarial parasites in his blood are examples of parasitic food chains. Often, parasitic relations are quite involved as parasites are transmitted through a variety of vectors or through unrelated intermediary host organisms. Like the other food chains, the ultimate source of energy for all auxiliary food chains is, solar energy originally harvested by plants.
Explain the term- Horizons These processes take a long time- may be a few thousand years to create a soil. As the time passes, the soil matures and generally becomes deeper and
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Decomposers - Biotic Components Also known as saprotrophs. Mostly, these are microscopic and are heterotrophic in nature. Decomposer organisms obtain their energy and nutrient
Q. How can the tubular-dorsal nervous system in chordates be compared to the nervous pattern present in invertebrates? In chordates the nervous system is dorsal and highly ceph
What is right patellar tendon Which of the following occur in response to an increase in the length of the right knee extensors in response to a quick tap applied to the right
Photosynthesis Photosynthesis - the process by which plants utilise energy from sunlight to convert carbon dioxide and water for the synthesis of sugar. This sugar can then be
An impermeable membrane separates a one liter solution of 1M NaCl in the left compartment from a one liter solution of 2M KCl in the right compartment. At 2 AM the membrane became
Plants are the source of a large variety of biochemicals which are metabolites of both primary and secondary metabolism. But secondary metabolites are of much greater interest s
Synthesis of citratefrom acetyl CoA and oxaloacetate: Citrate synthase catalyses this aldol condensation reaction with the release of CoA. There are certain inhibitors to this re
Incompatibility - Pollination and Fertilization Plants growing under natural conditions have a preference for their mating partners. The stigma of the female parent receives a
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd