Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Autoradiography is the process to detect radioactively labeled molecules (which commonly have been separated in an SDS-PAGE or agarose gel) based on their ability to develop an image on photographic or X-ray film. This procedure does not result in a linear relationship between the intensity of the signal and the amount of the radioactivity unless special steps are taken. There is now increasing use of the phosphorimagers and other modern devices to detect and quantitative radioactive molecules which have been separated in gels.
Technological level - Pollution control Air pollution can be reduced by using bag filters, electrostatic precipitators and cyclone separators that separate large and small par
Supply of Animals: Lab animals must be obtained from accredited dealers and by accredited dealers, we mean suppliers in the business of supplying animals for lab use, and not from
Talk about briefly three of the common enteric diseases caused by inadequate clean water supply and insufficient sanitation facilities. Your talk should contain the source and spr
Vitamin A dry powder Vitamin A dry powder is used in the (manufacture of dry mixtures) for which the oily ester concentrates are unsuitable or undesirable. Mainly, they are inc
Seed A seed is a mature ovule enclosing an embryonic plant, stored food material (in endosperm, persistent nucellus or embryo itself) and a seed coat formed by one or two inte
Define Promoting food security to control under nutrition? Public distribution of food grains through a network of ration shops, particularly to reach the population below the
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
What is the difference between taeniasis and cysticercosis? Taeniasis is the parasitic disease caused by the adult tapeworm installed within the human intestine. Cysticercos
Define Factors that affect the requirement of Protein? Protein requirement is greatly influenced by many factors such as age, environmental temperature, energy intake, gender,
Why is the plant life cycle known as alternation of generations? The plant life cycle is called as alternation of generations because in this cycle there are two dissimilar for
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd