Autoradiography, Biology

Assignment Help:

Autoradiography is the process to detect radioactively labeled molecules (which commonly have been separated in an SDS-PAGE or agarose gel) based on their ability to develop an image on photographic or X-ray film. This procedure does not result in a linear relationship between the intensity of the signal and the amount of the radioactivity unless special steps are taken. There is now increasing use of the phosphorimagers and other modern devices to detect and quantitative radioactive molecules which have been separated in gels.


Related Discussions:- Autoradiography

Can you explain mitotic apparatus, Q. What is mitotic apparatus? Mitoti...

Q. What is mitotic apparatus? Mitotic apparatus is the set of aster fibers, radial structures around each centriole pair, plus the spindle fibers, fibers that extend across the

Conduction, Conduction An action potential occurs at one point along t...

Conduction An action potential occurs at one point along the axon. Yet we know that neurological impulses are not fixed, they travel along a neuron. So how can the action pote

Biological properties of protoplasm, BIOLOGICAL PROPERTIES OF PROTOPLASM - ...

BIOLOGICAL PROPERTIES OF PROTOPLASM - 1 .       Respiration - Oxidation of food to liberate energy is respiration. Every living beings respire but every living beings do no

Bronchiectasis, Bronchiectasis: Bronchiectasis literally means abnorma...

Bronchiectasis: Bronchiectasis literally means abnormal dilation of bronchi. It is a chronic  inflammatory condition which is characterised  by permanent dilation of bronchi a

Is there respiratory pigment in the annelid blood, Q. Is there respiratory ...

Q. Is there respiratory pigment in the annelid blood? The blood in beings of the phylum Annelida contains the respiratory pigment hemoglobin the same found in chordates and oth

Of what subunits are ribosomes are made, Q. Of what subunits are ribosomes ...

Q. Of what subunits are ribosomes are made? Ribosomes are made of two subunits the small subunit and the large subunit. These subunits are made of proteins and ribosomic RNA (r

Agro industrial-iodine, Iodine Iodine functions are essential componen...

Iodine Iodine functions are essential components of the thyroid hormones thyroxine (T 4) and triiodothyronine (T3), which regulate the rate of energy metabolism. Absorbed iodi

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Define oxidised starch, Oxidised starch Oxidised starch finds a number ...

Oxidised starch Oxidised starch finds a number of uses in the food industry where a neutral tasting, low viscosity 'body builder' is required as in lemon curd manufacture, in s

Discuss about intracellular perfusion fluid, At 1 AM, a healthy squid giant...

At 1 AM, a healthy squid giant axon is placed in a bath of normal squid physiological extracellular saline and is internally perfused with normal squid intracellular saline.  I

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd