Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Autoradiography
Autoradiography is a modification of the radioactive tracer technique. In this technique, the radioactivity is detected by a thin film of photographic emulsion containing silver compounds which is put over a labelled cell or tissue. The rays emitted by radioisotope from the cell or tissue expose the photographic emulsion like a photographic film which is developed in a dark room. Silver grains are seen as black dots on parts of the specimen where radioisotope is accumulated.
Autoradiography reveals the metabolic processes of the cell. For example, by labelling cells with 3H thymidine, it is found that silver grains are localised in nucleus, which shows that DNA is synthesised in the nucleus. Similarly, by labelling cells with 3H uridine, silver grains are first seen in nucleus and then after some time these grains appear in the cytoplasm. This clearly demonstrates that RNA is initially synthesised in the nucleus but later on migrates to the cytoplasm.Different radioisotopes are used for localising different macromolecules. As stated earlier, cells are labelled with 3H thymidine for the studX of DNA metabolism, 3H uridine to study RNA metabolism, tritiated amino acids for examining the synthesis of proteins, treated monosaccharides such as 3H-mannose and 3H-fucose for examining the synthesis of polysaccharides.
Agrostology : This is related to all types of grasses. Agrostology is sometimes called as graminology. Agrostology is the scientific study of grasses. It typically encompasses the
Explain the Bulimia Nervosa? Diagnostic Criteria Bulimia Nervosa patients, unlike those of anorexia nervosa with binge and purge subtype, are typically within the normal weight
Q. Show the Use of Incineration for sterilization? This is an excellent method for rapidly destroying materials such as soiled dressings, animal carcasses, bedding and patholog
What (a) internal, (b) external events contribute to gain of heat in the body? a) Respiration in the tissues, particularly in the brain and active muscles, is the major in
Digestion of Carbohydrates Digestion of food starts in the mouth itself by the action of enzyme salivary amylase and the carbohydrates present in the food, particular
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Ask question #Minimum 100 words what is joint accepted#
The law of contract is that the branch of law which determines the circumstances in which promises made by the parities to a contract shall be legally binding on them. Its rules de
Q. Complications of diverticular disease? The many complications of the disease include the 'following conditions: • A perforation (hole) in the intestine leading to perito
Population Growth - Population Parameters and Regulation The size of a population depends upon the balance between natality and immigration through which individuals are added
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd