Autoradiography, Biology

Assignment Help:

Autoradiography

Autoradiography is a modification of the radioactive tracer technique. In this technique, the radioactivity is detected by a thin film of photographic emulsion containing silver compounds which is put over a labelled cell or tissue. The rays emitted by radioisotope from the cell or tissue expose the photographic emulsion like a photographic film which is developed in a dark room. Silver grains are seen as black dots on parts of the specimen where radioisotope is accumulated.

Autoradiography reveals the metabolic processes of the cell. For example, by labelling cells with 3H thymidine, it is found that silver grains are localised in nucleus, which shows that DNA is synthesised in the nucleus. Similarly, by labelling cells with 3H uridine, silver grains are first seen in nucleus and then after some time these grains appear in the cytoplasm. This clearly demonstrates that RNA is initially synthesised in the nucleus but later on migrates to the cytoplasm.

Different radioisotopes are used for localising different macromolecules. As stated earlier,  cells are labelled with 3H thymidine for the studX of DNA metabolism, 3H uridine to study RNA metabolism, tritiated amino acids for examining the synthesis of proteins, treated monosaccharides such as 3H-mannose and 3H-fucose for examining the synthesis of polysaccharides.


Related Discussions:- Autoradiography

Agrostology, Agrostology : This is related to all types of grasses. Agrosto...

Agrostology : This is related to all types of grasses. Agrostology is sometimes called as graminology. Agrostology is the scientific study of grasses. It typically encompasses the

Explain the bulimia nervosa, Explain the Bulimia Nervosa? Diagnostic Cr...

Explain the Bulimia Nervosa? Diagnostic Criteria Bulimia Nervosa patients, unlike those of anorexia nervosa with binge and purge subtype, are typically within the normal weight

Show the use of incineration for sterilization, Q. Show the Use of Incinera...

Q. Show the Use of Incineration for sterilization? This is an excellent method for rapidly destroying materials such as soiled dressings, animal carcasses, bedding and patholog

External events contribute to gain of heat in the body, What (a) internal, ...

What (a) internal, (b) external events contribute to gain of heat in the body?   a) Respiration in the tissues, particularly in the brain and active muscles, is the major in

Digestion of carbohydrates, Digestion of Carbohydrates Digestion of foo...

Digestion of Carbohydrates Digestion of food starts in the mouth  itself by the action  of  enzyme  salivary  amylase  and  the  carbohydrates present  in  the food, particular

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Joint, Ask question #Minimum 100 words what is joint accepted#

Ask question #Minimum 100 words what is joint accepted#

Objective of the law of contract, The law of contract is that the branch of...

The law of contract is that the branch of law which determines the circumstances in which promises made by the parities to a contract shall be legally binding on them. Its rules de

Complications of diverticular disease, Q. Complications of diverticular dis...

Q. Complications of diverticular disease? The many complications of the disease include the 'following conditions: • A perforation (hole) in the intestine leading to perito

Population growth - population parameters, Population Growth - Population P...

Population Growth - Population Parameters and Regulation The size of a population depends upon the balance between natality and immigration through which individuals are added

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd