Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Astrobiology: This is the branch of scientific enquiry dealing with the possibility of life in the outer space. Astrobiology is a type of study of the evolution, origin, distribution or future of life in the universe. Astrobiology encompasses the search for habitable environments in our Solar System or habitable planets outside our Solar System. Astrobiology addresses the question of whether life can exist beyond Earth or how humans can detect it if it happens. The term exobiology is similar to astrobiology but more specific because it covers the search for life beyond Earth, and the effects of extraterrestrial environments on living things.
Astrobiology makes use of astronomy, physics, chemistry, biology, ecology, molecular biology, planetary science, geology or geography to investigate the possibility of life on other worlds and help us to recognize biospheres that might be different from the biosphere on Earth. Astrobiology concerns itself with interpretation of existing scientific data or it give us more detailed or reliable data from other parts of the universe.
Derived Proteins These are not naturally occurring proteins and are obtained from simple proteins by the action of enzymes and chemical agents, heat, mechanical shaking, UV or
A restriction enzyme or restriction endonuclease is an enzyme which cuts DNA at particular recognition nucleotide sequences with Type II restriction enzymes cutting double-stranded
Cryptosporidiosis Cryptosporidiosis, a protozoan disease of the intestinal tract, is caused by Cryptosporidium parvum and Cryptosporidium muris. It infects man, dog, cat, calves,
SUBERIN It is a lipid formed by esterification of phellonic acid or its derivative with glycerol. Suberin occurs in the walls of cork cells and endodermal cells. It makes
What is an example of a situation in which the neuron cell body is located in a part of the body and its axonal terminal portion is in another distant part of the body? Why does th
whats ur clear definition of virus
Explain Diffusion and Osmosis in cell structure? Diffusion and Osmosis : Diffusion through a cell membrane occurs as it does elsewhere, from an area of high concentration of
These are found in about 3-6 per cent of cases of ARF. These nodules are typically subcutaneous, firm, painless, freely movable (0.5-2 cm size) and their presence indicates that t
Explain the Frank Furcal Perforation a) Coronal perforation at the pulpal floor of multirooted tooth. b) Due to excessive deepening at the pulpal floor during access perfora
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd