Astrobiology, Biology

Assignment Help:

Astrobiology: This is the branch of scientific enquiry dealing with the possibility of life in the outer space. Astrobiology is a type of study of the evolution, origin, distribution or future of life in the universe. Astrobiology encompasses the search for habitable environments in our Solar System or habitable planets outside our Solar System. Astrobiology addresses the question of whether life can exist beyond Earth or how humans can detect it if it happens. The term exobiology is similar to astrobiology but more specific because it covers the search for life beyond Earth, and the effects of extraterrestrial environments on living things. 

Astrobiology makes use of astronomy, physics, chemistry, biology, ecology, molecular biology, planetary science, geology or geography  to investigate the possibility of life on other worlds and help us to recognize biospheres that might be different from the biosphere on Earth. Astrobiology concerns itself with interpretation of existing scientific data or it give us more detailed or reliable data from other parts of the universe.

 


Related Discussions:- Astrobiology

Explain about derived proteins, Derived Proteins These are not naturall...

Derived Proteins These are not naturally occurring proteins and are obtained from simple proteins by the action of enzymes and chemical agents, heat, mechanical shaking, UV or

Whta is restrictions enzymes, A restriction enzyme or restriction endonucle...

A restriction enzyme or restriction endonuclease is an enzyme which cuts DNA at particular recognition nucleotide sequences with Type II restriction enzymes cutting double-stranded

Cryptosporidiosis, Cryptosporidiosis Cryptosporidiosis, a protozoan diseas...

Cryptosporidiosis Cryptosporidiosis, a protozoan disease of the intestinal tract, is caused by Cryptosporidium parvum and Cryptosporidium muris. It infects man, dog, cat, calves,

Suberin, SUBERIN It is a lipid formed by esterification of phellonic ac...

SUBERIN It is a lipid formed by esterification of phellonic acid or its derivative with glycerol. Suberin occurs in the walls of cork cells and endodermal cells. It makes

Explain the axonal terminal portion, What is an example of a situation in w...

What is an example of a situation in which the neuron cell body is located in a part of the body and its axonal terminal portion is in another distant part of the body? Why does th

Virus, whats ur clear definition of virus

whats ur clear definition of virus

Explain diffusion and osmosis in cell structure, Explain Diffusion and Osmo...

Explain Diffusion and Osmosis in cell structure? Diffusion and Osmosis :  Diffusion through a cell membrane occurs as it does elsewhere, from an area of high concentration of

Subcutaneous nodules, These are found in about 3-6 per cent of cases of ARF...

These are found in about 3-6 per cent of cases of ARF. These nodules are typically subcutaneous, firm, painless, freely movable (0.5-2 cm size) and their presence indicates that t

Explain the frank furcal perforation, Explain the Frank Furcal Perforation ...

Explain the Frank Furcal Perforation a) Coronal perforation at the pulpal floor of multirooted tooth. b) Due to excessive deepening at the pulpal floor during access perfora

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd