Astrobiology, Biology

Assignment Help:

Astrobiology: This is the branch of scientific enquiry dealing with the possibility of life in the outer space. Astrobiology is a type of study of the evolution, origin, distribution or future of life in the universe. Astrobiology encompasses the search for habitable environments in our Solar System or habitable planets outside our Solar System. Astrobiology addresses the question of whether life can exist beyond Earth or how humans can detect it if it happens. The term exobiology is similar to astrobiology but more specific because it covers the search for life beyond Earth, and the effects of extraterrestrial environments on living things. 

Astrobiology makes use of astronomy, physics, chemistry, biology, ecology, molecular biology, planetary science, geology or geography  to investigate the possibility of life on other worlds and help us to recognize biospheres that might be different from the biosphere on Earth. Astrobiology concerns itself with interpretation of existing scientific data or it give us more detailed or reliable data from other parts of the universe.

 


Related Discussions:- Astrobiology

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Advice on dischargeperi operative problems, Advice on Discharge :  Patient...

Advice on Discharge :  Patients are allowed to go home on 8th or 9th day. It could be even earlier after off pump coronary artery surgery (OPCAB). They should gradually increase t

Blood pressure with the phenomena of systole and diastole, Q. What is the r...

Q. What is the relation between the maximum and the minimum blood pressure with the phenomena of systole and diastole? A minimum blood pressure is the pressure on the wall of t

Describe alternation of generations, Describe Alternation of Generations? ...

Describe Alternation of Generations? Alternation of Generations :  In meiosis, four haploid daughter cells are formed from one diploid mother cell. The life cycles of sexuall

Why it is important to study about soil, Why does one need to study about s...

Why does one need to study about soil and what is  its importance? You would be aware that, from the dawn of agriculture, cultivators were attracted to fertile soils of river

Differ from our current use of retroviruses, In what way may we be able to ...

In what way may we be able to take advantage of retrotransposons in human gene therapy? How would this differ from our current use of retroviruses?

Excretion, what are the excretory organs of birds

what are the excretory organs of birds

Respiratory insufficiency and respiratory failure, Respiratory Insufficienc...

Respiratory Insufficiency Respiratory insufficiency usually indicate inadequate exchange of oxygen and carbondioxide to meet the needs of the body during normal activities.

What is hipot test ?, Hipot is an abbreviation for high potential. Usually,...

Hipot is an abbreviation for high potential. Usually, Hipot is a term given to a class of electrical safety testing instruments used to confirm electrical insulation in finished ap

What devices used for oxygen therapy, What Devices Used for Oxygen Therapy?...

What Devices Used for Oxygen Therapy? Variable performance systems: With these devices, the FiO 2 would vary depending on the patient's breathing pattern. In general, rapid, s

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd