Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
ANTICOAGULANTS
(a) Heparin (hepar = liver) . It is synthesized by mast cells of connective tissue and liver cells. It is a heteropolysaccharide. It increases the effectivity of antithrombin III (a - globulin) which inactivates the thrombin so prevents conversion of fibrinogen into fibrin.
(b) Hirudin. It is an anticoagulant present in the saliva of salivary glands of leech and is mixed with blood of host during its storage in its crop.
(c) Warfarin. It is an anticoagulant of plant origin, which when given to a patient, lowers the formation of prothrombin and factors VII, IX and X from liver cells by lowering the activity of Vitamin K.
(d) Sodium oxalate, sodium citrate and EDT A (Ethylene diamine tetra acetic acid) are used as anticoagulants in blood banks as these bind Ca++, so these are called chelating agents. .
(e) Chilling of blood also delays blood clotting as it lowers the activity of enzymes involved in blood clotting.
ROLE OF VITAMIN-K IN BLOOD CLOTTING -
Vitamin K, also called anti-haemorrhagic factor, is a fat soluble vitamin and is essential for the formation of prothrombin from the liver. Deficiency of vitamin K causes hypoprothrombinemia which interferes with blood clotting. Vitamin K is also synthesized by intestinal bacteria.
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
wdomestic effluent hat is
Explain radiation sterilization Various studies have been conducted which show the effect of processing on vitamins especially, thiamine. In one study, which compared the effec
Equipment : Basically, it has an intra aortic balloon pump. A balloon with a capacity of 40 ml is passed percutaneously through the femoral artery up to the upper end of descen
Reducing Cost of Accident One clear way to control the cost of accident would be to follow all the rules of book for safety. All the methods of safety which were described ear
Explain the types of modified gellan gum There are 3 types of modified gellan gum. (a) High acetyl gellan (partially deacetylated), which provides a thermo reversible gel,
Q. Enumerate various factors controlling osseointegration? The factors controlling osseointegration are: i) Occlusal load ii) Biocompatibility of the material iii) Imp
Explain about natural pigments There has been an extensive search of the microbial, plant and animal kingdoms for pigments that possess both high tinctorial power/strength (a m
How do pathological conditions affect homeostasis of your body?
Necessity of interdependence of Volvox organisms in the colonial existence
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd