Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Animals - Slow Moving Waters
Zooplankton are common here and include an assemblage of protozoa and smaller crustacean, such as water flies, and copepods. Neuston occurring here are several insects such as water striders, water boatman, backswimmers and predaceous diving beetles, all of which spend most of their time at the surface of the stream.
The nektons are numerous and include large crustaceans like the fresh water shrimp and many types of insects and fishes such as carp and catfish all of which are different species from those of the fast water regions. The benthos here include the snow bugs, mayfly naiads and dragonfly naiads which occur on the surface of the benthic region and the tubeworms, naiads of burrowing mayflies and rotifers which bury into it.
Q. Why in bread and cake manufacture are alcoholic fermenting organisms used and not lactic fermenting organisms? Fermentation has the function of making breads and cakes grow
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Normal 0 false false false EN-IN X-NONE X-NONE
COMPOSITION Proteins = 44-76%, Lipids = 20-53%, Carbohydrates = 1-8%, (Protein-Lipid ratio = 0.8 : 1 to 4 : 1) Most of lipid are "Phospholipids" which are amphipat
Preparation on the Previous Day of Operation Remove all the jewellery, nail polish, cut nails. The patient's body is cleaned - shaving from chin to toe, inclu
What is the General Cognitive Ability General cognitive ability is usually assessed using standardised intelligence tests, such as Wechsler Intelligence Scale for Children Thir
Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4
Pomology : This is the study of fruits and fruit yielding plants of commercial importance. Pomology is a branch of botany which studies or cultivates pome fruit, and particularly
Define the Quantitative Analysis in Nutritional Biochemistry? Quantitative analysis involves the measurement of the amount of a substance present. This measurement can be done
Cardiac surgical intervention has an increasingly important role in the treatment of intracardiac complications of endocarditis. Retrospective data suggest that mortality is unacce
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd