Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Explain the Physical Methods to Control Microorganisms? The physical methods to control microorganisms involve heat, filtration or radiations. Figure illustrates these methods.
ATP is DIRECTLY required in which of the following processes in muscle? A. Net flux of sodium ions from intracellular space to extracellular space. B. Detachment of myosin h
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Fragmentation - Types of Asexual Reproduction Fragmentation is a phenomenon where parent animal spontaneously (on its own accord) splits into two or more fragments. Each one o
MALE REPRODUCTIVE DISORDERS Generally, about 5-10% of cattle bulls reaching sexual maturity would be suffering from poor reproductive efficiency or sterility. Crossbreeding ha
a) The elongation level of translation in eukaryotes requires three elongation factors, eEF-IB, eEF-1A and eEF-2, that have similar functions to their prokaryotic counterparts EF-G
Q What are the few examples of annelids? Earthworms, lugworms and leeches. Q. Which are the morphological features that differentiate the beings of the phylum Annelida from
Q. Investigations process of acute pericarditis? 1) Blood Examination Erythrocyte sedementaion rate (ESR) may be elevated in tuberculous; collagen and purulent pericarditis.
Types of Axons Axons are of two types Myelinated and Non-myelinated In the case of myelinated axons the neurilemma is ensheathed by another cover
Uses of Grafting Grafting helps to preserve and perpetuate varieties that cannot reproduce by vegetative method. Grafting changes less useful varieties to more desirable
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd