Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. Anatomic Factors in Patient Selection for Mitral Valvuloplasty ?
The ideal patient is young, has pliable non calcified mitral leaflets, and mild subvalvular disease. TEE may be necessary to exclude LA thrombus and significant mitral regurgitation pre-procedure. Massive valvular calcification and bicommisural calcification are obviously contraindications for the procedure
The echocardiographic scoring system by Wilkins et al is very helpful to decide an anatomically suitable valve for Mitral Valvuloplasty. The maximum score is 16. A score of < 8 generally gives excellent results.
Q. Write the definition of counselling? The counselling process, involves various steps in a sequence as given below: 1. Rapport-Building 2. Locating the Problem 4. Pl
What is Exposure Assessment Exposure Assessment : The qualitative and quantitative evaluation of the degree of intake likely to occur.
could you please give me a data in the form of tabular column based on milk analysis which can be done in home itself?
what is qualities of phylum porifera
Ask question #i need the complete table having the names of the diseases their causative agents and their control,caused by air-borne pathogens?
Q. Symptoms of gastro oesophageal reflux disease? Most commonly, people with GERD complain of heartburn, a painful or uncomfortable feeling in the chest, which may radiate to t
Determine Minerals Requirements at high altitude? Increased urinary excretion of Nat and K + on exposure to hypoxia is reported while some workers have found only increase in
Describe the Organization of the Vascular Plant Body? A typical plant body consists of two distinct systems: a root system and a shoot system. The root system is usually below
Give detail explanation about Swimming Swimming is an excellent form of exercise. Swimming can improve the posture and circulation. It is a healthy activity. There are certain
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +1-415-670-9521
Phone: +1-415-670-9521
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd