Anatomic factors in patient selection for mitral valvuloplas, Biology

Assignment Help:

Q. Anatomic Factors in Patient Selection for Mitral Valvuloplasty ?

The ideal patient is young, has pliable non calcified mitral leaflets, and mild subvalvular disease. TEE may be necessary to exclude LA thrombus and significant mitral regurgitation pre-procedure. Massive valvular calcification and bicommisural calcification are obviously contraindications for the procedure

The echocardiographic scoring system by Wilkins et al is very helpful to decide an anatomically suitable valve for Mitral Valvuloplasty. The maximum score is 16. A score of < 8 generally gives excellent results.


Related Discussions:- Anatomic factors in patient selection for mitral valvuloplas

Write the definition of counselling, Q. Write the definition of counselling...

Q. Write the definition of counselling? The counselling process, involves various steps in a sequence as given below: 1. Rapport-Building 2. Locating the Problem 4. Pl

What is exposure assessment, What is Exposure Assessment Exposure Asse...

What is Exposure Assessment Exposure Assessment :  The qualitative and quantitative evaluation  of the  degree  of  intake likely  to occur.

Analysis of different milk samples, could you please give me a data in the ...

could you please give me a data in the form of tabular column based on milk analysis which can be done in home itself?

Microbiology of air, Ask question #i need the complete table having the nam...

Ask question #i need the complete table having the names of the diseases their causative agents and their control,caused by air-borne pathogens?

Symptoms of gastro oesophageal reflux disease, Q. Symptoms of gastro oesoph...

Q. Symptoms of gastro oesophageal reflux disease? Most commonly, people with GERD complain of heartburn, a painful or uncomfortable feeling in the chest, which may radiate to t

Determine minerals requirements at high altitude, Determine Minerals Requir...

Determine Minerals Requirements at high altitude? Increased urinary excretion of Nat and K + on exposure to hypoxia is reported while some workers have found only increase in

Describe the organization of the vascular plant body, Describe the Organiza...

Describe the Organization of the Vascular Plant Body? A typical plant body consists of two distinct systems: a root system and a shoot system. The root system is usually below

Give detail explanation about swimming, Give detail explanation about Swimm...

Give detail explanation about Swimming Swimming is an excellent form of exercise. Swimming can improve the posture and circulation. It is a healthy activity. There are certain

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd