Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Anaphase
This phase is of shortest duration. It begins with a sudden separation of the two chromatids of each due to splitting of its centromere and then a slow movement of separted chromatids towards opposite poles of mitotic spindle . Factors responsible for splitting of centromeres and movement of attachment fibres, or the fibres gradually shorten, pulling the chromatids towards the poles. Shortening of these fibres may be due to their contraction (due to the presence of contractile actin proteinin these ) or their gradual depolymeriaztion at polar ends Simultaneously, however the continuous spindle fibres somewhat elongate, pushing the spindle poles more apart. Towards the end of anaphase when polar migration of chromatids is complete , these is a full chromosomal complement at each pole identical to the original karyotype of parent cell. Soon, a nuclear envelope forms around each polar group, presumably from the endoplasmic reticulum.
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
????? # 100 ??????????? #Minimum ?????? ?????
Pelagic Zone - Organisation of the Marine Ecosystem The waters contained in the sea basin, constitute the pelagic zone which is divided into The neritic zone situ
Give ditail account on regernation in invertebrates and vertabrites
Biological catalysts à speed up chemical reactions in the body without being consumed in the process Reduce the activation energy needed for reactants to reach the transit
Q. How do birds reproduce? Birds like every vertebrate have sexual reproduction. Their embryos develop within shelled eggs containing extraembryonic membranes and exterior the
Q. Which are the glands present in the epidermis of birds, reptiles and mammals? In the epidermis of reptiles and birds there are practically no glands. In mammals there are se
There are a broad range of various process for cloning DNA into either viral or plasmid vectors but the basic scheme of events is frequently same. To clone into a pl
Viriods and Prions Viroids In 1971, T.O.Diener reported that the spinde tuber disease of potato causing gnarling and cracking of the tuber, is caused by multiplica
Explain Cis-trans isomers Atoms or groups are called cis or trans to one another when they project respectively on the same or on opposite sides of a reference plane identi
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd