Anaphase, Biology

Assignment Help:

Anaphase

This  phase is of shortest duration. It  begins  with  a sudden  separation  of the two chromatids of each   due  to splitting   of its centromere and  then a slow movement of  separted  chromatids  towards  opposite  poles  of mitotic   spindle . Factors responsible for splitting of centromeres and movement  of attachment  fibres, or  the fibres gradually  shorten,  pulling the chromatids towards   the  poles. Shortening of these  fibres may be due to their  contraction (due  to the  presence of contractile actin  proteinin these ) or  their  gradual depolymeriaztion  at polar  ends Simultaneously, however  the continuous spindle fibres somewhat  elongate, pushing the  spindle  poles more apart. Towards  the end of anaphase  when polar migration  of chromatids is complete , these  is a full  chromosomal  complement  at each  pole identical to the original karyotype  of parent cell. Soon, a nuclear envelope forms around each polar group, presumably from the endoplasmic reticulum.


Related Discussions:- Anaphase

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Class of coclentrata, ????? # 100 ??????????? #Minimum ?????? ?????

????? # 100 ??????????? #Minimum ?????? ?????

Pelagic zone - organisation of the marine ecosystem, Pelagic Zone - Organis...

Pelagic Zone - Organisation of the Marine Ecosystem The waters contained in the sea basin, constitute the pelagic zone which is divided into The neritic zone situ

Regernation, Give ditail account on regernation in invertebrates and verta...

Give ditail account on regernation in invertebrates and vertabrites

Enzymes, Biological catalysts à speed up chemical reactions in the body wit...

Biological catalysts à speed up chemical reactions in the body without being consumed in the process Reduce the activation energy needed for reactants to reach the transit

How do birds reproduce, Q. How do birds reproduce? Birds like every ver...

Q. How do birds reproduce? Birds like every vertebrate have sexual reproduction. Their embryos develop within shelled eggs containing extraembryonic membranes and exterior the

Epidermis of birds - reptiles and mammals, Q. Which are the glands present ...

Q. Which are the glands present in the epidermis of birds, reptiles and mammals? In the epidermis of reptiles and birds there are practically no glands. In mammals there are se

The basics of dna cloning, There  are a broad  range  of various  process  ...

There  are a broad  range  of various  process  for cloning  DNA  into  either viral  or plasmid vectors  but the basic  scheme  of events  is frequently  same.  To clone into a pl

Viriods and prions, Viriods and Prions Viroids        In 1971, T.O...

Viriods and Prions Viroids        In 1971, T.O.Diener reported that the  spinde tuber disease of potato causing gnarling and cracking of the tuber, is caused by multiplica

Explain cis-trans isomers, Explain Cis-trans isomers Atoms or groups a...

Explain Cis-trans isomers Atoms or groups are called  cis or  trans to one another when they project respectively on the same or on opposite sides of a reference plane  identi

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd