Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. Analyze the Regional Wall Motions?
Ans.
Various attempts have been made in the past to try and quantify the ischemic myocardium, however till date the best and most widely used is the 16 segment scoring system, which has also been approved by American society of Echocardiography. The system was devised keeping in mind the common pattern of coronary blood supply. The whole of the left ventricle muscle is divided into 16 segments, which can be visualized in the conventional views. The whole length of the LV is divided into 3 segments. The apical, mid segment and basal segment. The circumference of basal and mid myocardium is divided into 6 segments-Anterior Segment, Anterior wall, lateral wall, posterior wall, inferior wall and septum. The apical portion however lacks anterior septum and posterior wall.
If the translate these segments into other conventional views, we find that parasternal long axiq view shows anterior septum and posterior wall, apical 4 chamber view show$ septum and lateral wall and apical 1 chamber view shows inferior and anterior; wall.
With variable degree of overlap the segments marked above denote coronary artery territory. These can be plotted on a Bull's eye plot, which gives a better appreciation of the segments and the regions involved.
Is fecundation in amphibians external or internal? In this aspect are amphibians evolutionarily proximal to fishes or to reptiles? In the majority of the amphibian species fec
It has been shown by prospective studies that Rheumatic heart disease (RHD) is linked to the occurrence of carditis during the first episode of ARF. If the first episode is accompa
Define Reagent for Separation of Amino Acid by Paper Chromatography? The following reagents will be required for carrying out the experiment: 1. Amino acid solution- Weig
Explain the Eukaryotic Gene Expression ? Eukaryotic cells regulate the transcription of individual genes, large parts of chromosomes, or even entire chromosomes. Gene expressi
What are the cell types that form the phloem? What are the main features of those cells? The major cells that form the phloem are the sieve elements and the companion cells. Th
Q. What are biogeochemical cycles? The Biogeochemical cycles are representations of the circulation and recycling of matter in nature. The major biogeochemical cycles studie
Human embryo: After fertilization the human embryo divides mitotically and develops two membranes: 1) Chorion 2) Amnion Functions of the membranes: i) Chorion : It
what are the uses of computer in biotechnology ??? briefly explain any twenty
What are plant hormones? Plant hormones, also known as phytohormones, are substances that control the embryonic development and the growth of the adult plant.
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd