analogous, Biology

Assignment Help:
define analogous

Related Discussions:- analogous

Explain the future challenges for neuroscience, Explain the Future challeng...

Explain the Future challenges for Neuroscience? When the analysis of single cells and even networks has progressed very nicely, there still remain many significant questions. A

Determine the horner ''s pupil disease, Determine the Horner 's Pupil disea...

Determine the Horner 's Pupil disease Homer's syndrome occurs because of ipsilateral interruption of the sympathetic outflow to the head and neck. It can result from lesions an

Parasitic adoptaion in animal, #question.what do u mean by parasitic habit....

#question.what do u mean by parasitic habit.give account of various parasitic adoptation in animal.

Theory of natural selection, What key idea, contained in Malthus's essay on...

What key idea, contained in Malthus's essay on populations, helped Darwin formulate his theory of natural selection?

Solubility of gases in water, Solubility of Gases in water Most gases w...

Solubility of Gases in water Most gases which are important for biological processes dissolve readily and specially in water. The solubility of any gas in water generally var

What are the types of nutrients, Q. What are the types of nutrients? Explai...

Q. What are the types of nutrients? Explain the functions of nutrients? Types of nutrients  • Carbohydrates • Proteins • Fats • Minerals • Vitamins • Water Fu

Describe the factors that affect cardiac, Describe the factors that affect ...

Describe the factors that affect cardiac output in a female athlete who is speed skating toward the finish line in an Olympic race.

Clone (verb), Clone (verb) is the action of duplicating the genetic materi...

Clone (verb) is the action of duplicating the genetic material within a vector. To clone the piece of DNA, one would insert it into some type of the vector (like, a plasmid) and p

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Cardiomyocytes and motor neurons, Describe the mechanisms and genetic regul...

Describe the mechanisms and genetic regulations that underpin how two cells such as cardiomyocyte and a motor neuron have identical gnomes, yet are functionally and structurally di

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd