analogous, Biology

Assignment Help:
define analogous

Related Discussions:- analogous

What do you mean by insect control, Q. What do you mean by Insect control? ...

Q. What do you mean by Insect control? The insects can breed and hide in garbage and other places where there is availability of waste materials. The cockroach lives and breed

Work sheet, When the Balance Sheet column totals don't agree on the first a...

When the Balance Sheet column totals don't agree on the first attempt work backward through the process used in preparing the work sheet exclusively take the following steps until

Complications during angina pectoris, Q. Complications during angina pector...

Q. Complications during angina pectoris? It is a symptom giving a warning of impending myocardial infarction, sudden cardiac death or even ischemic necrosis of the brain leadin

Explain about the spectrophotometer, Explain about the Spectrophotometer? ...

Explain about the Spectrophotometer? The spectrophotometer, a key instrument today in biomedical laboratories, was invented in 1939 by the American chemist Arnold O. Beckman (1

What is transgenic animal, Question 1 Write a short note on the following- ...

Question 1 Write a short note on the following- Transfection Synthetic seeds Transgenic crops Agrometerology Question 2 Describe any 5 screening techniques use

Fixation and movement to echinoderms, Q What is the system that permits fix...

Q What is the system that permits fixation and movement to echinoderms? The system that permits fixation and movement to substrates in echinoderms is called the ambulacral syst

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

According to their morphology how are bacteria classified, According to the...

According to their morphology how are bacteria classified? Bacteria present dissimilar morphological patterns. A bacterium can be classified into coccus, bacillus, vibrion or s

What is aortic enlargement, Q. What is Aortic Enlargement ? Ascending ...

Q. What is Aortic Enlargement ? Ascending Aorta: The ascending aorta, along with the SVC forms a portion of the right cardiac border on the PA view. After the age of about 40

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd