amphibian, Biology

Assignment Help:
what is amphibian

Related Discussions:- amphibian

Explain about the cheese making - methods of food processing, Explain about...

Explain about the Cheese Making - methods of food processing? Cheese is a way of preserving milk for long periods of time. In this process, the milk in cheese becomes something

Zoonoses disease-classification modes of transmission, Classification acco...

Classification according to the modes of transmission 1.  Direct zoonoses: The direct zoonoses are those zoonoses that are transmitted from an infected vertebrate host to a

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain culture characteristics of molds, Q. Explain Culture Characteristic...

Q. Explain Culture Characteristics of Molds? The gross appearance of a mold growing on a food often is sufficient to indicate its class or order. Some molds are loose and fluff

Define about the metabolism of selenium compounds, Define about the Metabol...

Define about the Metabolism of Selenium compounds? Selenium compounds' are generally very efficiently absorbed by humans and selenium absorption does not appear to be' under ho

Diabetes mellitus, Diabetes mellitus, Types I and II is a disorder regard...

Diabetes mellitus, Types I and II is a disorder regarding the defects in insulin action. Type I diabetes is characterized by an inadequate insulin secretion; Type II diabetes is

How to devise a series of dilutions, A solution was prepared by dissolving ...

A solution was prepared by dissolving 25g NaOH powder in 100 ml water. Using not more than 15 ml water, devise a series of dilutions that will give a concentration of 5mg/ml NaOH.

Explain some important phospholipids, Explain some important phospholipids ...

Explain some important phospholipids The chemical structure of  phosphatidylcholine (lecithin) illustrated here in Figure is  typical of  the phosphatides  found in the brai

Inorganic nitrogen and sulphur metabolism, Inorganic Nitrogen and Sulphur M...

Inorganic Nitrogen and Sulphur Metabolism Productivity in agriculture, forestry and other ecosystems is basically limited by the availability of nitrogen nutrients like nitrat

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd