Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Amniocentesis is a way of prenatal testing in which the amniotic fluid is withdrawn from the uterus by the help of a needle. The fluid and the fetal cells it contains are analyzed to detect the biochemical or chromosomal disorders.
In his experiments, Mendel noted that when two traits are involved in a genetic cross, they are inherited independently of each other. The reason for this is that A. genes on the s
Define Micronutrient needs of a lactating mother? Vitamin and mineral deficiencies can have profound influence on the composition of milk. Calcium is a nutrient of special conc
Pomology : This is the study of fruits and fruit yielding plants of commercial importance. Pomology is a branch of botany which studies or cultivates pome fruit, and particularly
How dissimilar are the endosperm of gymnosperms and the endosperm of angiosperms? In the gymnosperms the endosperm is haploid (n), it is called as primary endosperm. In the ang
Define the Dietary and Lifestyle Modifications - Obesity? The management of obesity basically comprises the following three- pronged approach. a) Dietary modifications b)
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
a) The West of Scotland Coronary Prevention Study (WOSCOPS): The study randomized healthy men between the ages of 45 and 64 years with TC levels higher that 252 mg/dL and LDL chole
Mrs. TT seventy three-year old has a long history of chronic obstructive pulmonary disease (COPD). She came to the medical ward as shortness of breath, wheezing and a cough for the
What are the main negative ions found in living beings? The major anions found in living beings are the chlorine anion (Cl-), the phosphate anion (PO4--), the bicarbonate anion
1. A completely new protein has been synthesized by a research lab. You are inadvertently exposed to it and have an allergic response. What type of antibody initiates this respons
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd