ameoba, Biology

Assignment Help:
locomotion in amoeba

Related Discussions:- ameoba

How is the skin involved in the regulation of temperature, Q. How is the sk...

Q. How is the skin involved in the regulation of body temperature? Skin is one of various organ systems participating in maintaining a core temperature, meaning the temperature

How would you perform abo blood grouping, Question 1 How would you perform...

Question 1 How would you perform ABO blood grouping? Add a note on advantages and disadvantages of each method. Also discuss the precautions you may take to avoid errors in variou

Pattern of limb development, Pattern of Limb Development The first vi...

Pattern of Limb Development The first visible sign of limb development is the appearance of ridge or thickening on each lateral side of the embryo of amniotes. The ridge call

Hemicellulose, HEMICELLULOSE It consists of mannose, galactose, arab...

HEMICELLULOSE It consists of mannose, galactose, arabinose & xylose. It is a structural polysaccharide which helps in formation of cell wall. Maximum quantity of hemic

Left internal mammary artery and coronary artery, Left internal mammar...

Left internal mammary artery (LIMA): It is most often used for bypassing left anterior descending (LAD) coronary artery and its diagonal branch. The right internal mammary

Explain stem cell therapy, Stem Cell Stem cell therapy could enable ind...

Stem Cell Stem cell therapy could enable individuals to survive and contribute their alleles to the gene pool who might not have already done so thus increasing genetic diversi

Experiment of an egg osmometer, An egg osmometer Place some dilute hydr...

An egg osmometer Place some dilute hydrochloric acid or strong vinegar in a shallow dish, likeas a saucer, to a depth of about one centimetre. Hold the large end an egg in the

Care of eyes, CAR E OF EYES - 1.       Eyes should be periodically exa...

CAR E OF EYES - 1.       Eyes should be periodically examined in children. 2.       While reading the paper should be held 36 cm. away from eyes and preferable at an angle

Subphylum trilobitomorpha, Subphylum Trilobitomorpha Subphylum Trilobi...

Subphylum Trilobitomorpha Subphylum Trilobitomorpha involves the trilobites. All species are extinct and the fossils point out that they were all marine forms belonging to Pal

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd