Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. What kind of structure is the crystalline lens? What is its function? The crystalline is a converging spherical lens this natural lens has the function to project images of
(1) From the above gateway reaction (entry clone and destination vector); (i) which plasmid will be selected for when transformed into E.coli (A or B) and why? (ii) which an
B ovine parainfluenza This virus belongs to the genus Respirovirus in the subfamily Paramyxovirinae of family Paramyxoviridae. It causes respiratory syndrome in cattle and she
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
What are the so-called "good" and "bad" cholesterol? Lipoproteins are complexes made of lipids (triglycerides and cholesterol) and proteins. The lipoproteins present dissimilar
Q. Do squids and octopus have exoskeleton? Squids and Octopus generally do not produce external shell (some squid species can have an internal shell). One cephalopod group the
Describe the difference between dna and protein. (structural unit, linkage bond, primary and spatial structure)
Starch It is a plant polysaccharide synthesized by the plant by photosynthesis and stored mainly in grains, legumes, roots and tubers. Its molecular formula is (C 6 H 1
Describe PS with VSD in Tetralogy of Fallot's ? This group is also known as Tetralogy of Fallot's physiology. The classic example is Fallot's tetralogy characterized by: (1) Se
Q. What is the etiology of cholera? The most common cause of cholera is consumption of food or drinking water that has been contaminated with the bacteria. It is important to
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd