#ALIMENTARY SYASTEM.., Biology

Assignment Help:
#in which part of alimentary canal oblique muscle found?

Related Discussions:- #ALIMENTARY SYASTEM..

Explain administrative dietitian, Explain Administrative dietitian Admi...

Explain Administrative dietitian Administrative dietitian play  a  major  role in  large-scale meal planning  and monitoring the  food  preparation process  by  applying  the

What is human eye accommodation, What is human eye Accommodation The hu...

What is human eye Accommodation The human eye focuses at objects at infinity, without exerting any power. This means that when a person is observing an object at infinity, the

Succession - community change, Succession - Community Change The facto...

Succession - Community Change The factors like fire, floods and human interventions affect an ecosystem considerably. They often lead to the depletion or stripping off of orig

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

In unilocular ovary with a single ovule the placentation, In unilocular ova...

In unilocular ovary with a single ovule the placentation is : 1. Marginal 2. Basal 3. Free Central 4. Axile Basal

Excretion in animals, Excretion in Animals Excretion is concerned alon...

Excretion in Animals Excretion is concerned along with the removal of metabolic wastes that arise as a result of oxidation of energy rich compounds and metabolism of proteins

Explain composition of human milk, Explain Composition of Human Milk? R...

Explain Composition of Human Milk? Research clearly shows that each type of mammalian milk is unique and consists of a highly complex mixture of organic and inorganic compounds

Explain what is enzymes, Explain what is Enzymes? Enzymes are organic...

Explain what is Enzymes? Enzymes are organic substances that speed up, or catalyze, a chemical reaction. At a given temperature, molecules have varying amounts of energy, and

Depth and currents, Depth and Currents Depth The sea is v...

Depth and Currents Depth The sea is very deep varying in different regions. Generally life extends to all depths but is confined more to the continental shelf and

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd