Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
CobaltCobalt functions as a component of vitamin B12 (cobalamin). Ruminants are not dependent on a dietary source of vitamin B12 because ruminal microorganisms can synthesize B12 from dietary cobalt. The amount of dietary cobalt converted to vitamin B12 in the rumen has ranged from 3 to 13 % of intake. Supplementation of cobalt in the diet is known to increase the synthesis of ruminal vitamin B12.
What are some things that have algae in them? Yeast is considered Algae.
Q What is the alternative means for transport of substances in animals without a circulatory system? Why is blood important for larger animals? In animals that don't present th
Life cycle of Filarial worm Filariasis : It is popularly known as elephantiasis. It is caused by a nematode parasite, wuchereria bancrofti, and W.Malayi. Parasite : Wucher
How does the pancreatic juice resume the digestion of carbohydrates? What is the involved enzyme? Carbohydrate digestion starts with the action of the salivary amylase (ptyalin
Silver point extended below canal orifice - Ultra-sonic tip - Microtube tape: The post removal system (PRS) Trephine bur Masserann kit - Do trimming by
name two examples of biotechnology that use recombinant DNA technology and two examples that do nnot
NSP NSP or dietary fibre is the name given to a group of materials found in the cell walls of plants which gives the plant its structure and form. Food hydrocolloids Fo
Infectious bovine rhinotracheitis (IBR) The disease is caused by a Bovine Herpesvirus -I belonging to the family Herpesviridae and subfamily Alphaherpesvirinae. It is a DNA vir
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
During a fever in a human A. shivering may occur when the actual body temperature is lower than the set point for body temperature during the fever. B. there is an inc
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd