Agro industrial-cobalt, Biology

Assignment Help:

Cobalt
Cobalt functions as a component of vitamin B12  (cobalamin). Ruminants are not dependent on a dietary source of vitamin B12  because ruminal microorganisms can synthesize B12 from dietary cobalt. The amount of dietary cobalt converted to vitamin B12 in the rumen has ranged from 3 to 13 % of intake. Supplementation of cobalt in the diet is known to increase the synthesis of ruminal vitamin B12.


Related Discussions:- Agro industrial-cobalt

What are some things that have algae in them, What are some things that hav...

What are some things that have algae in them? Yeast is considered Algae.

Why is blood important for larger animals, Q What is the alternative means ...

Q What is the alternative means for transport of substances in animals without a circulatory system? Why is blood important for larger animals? In animals that don't present th

Life cycle of filarial worm, Life cycle of Filarial worm Filariasis : ...

Life cycle of Filarial worm Filariasis : It is popularly known as elephantiasis. It is caused by a nematode parasite, wuchereria bancrofti, and W.Malayi. Parasite : Wucher

Determine the digestion of carbohydrates, How does the pancreatic juice res...

How does the pancreatic juice resume the digestion of carbohydrates? What is the involved enzyme? Carbohydrate digestion starts with the action of the salivary amylase (ptyalin

Silver point extended below canal orifice, Silver point extended below cana...

Silver point extended below canal orifice -    Ultra-sonic tip -    Microtube tape: The post removal system (PRS) Trephine bur Masserann kit - Do trimming by

Use recombinant dna technology, name two examples of biotechnology that use...

name two examples of biotechnology that use recombinant DNA technology and two examples that do nnot

Explain nsp and food hydrocolloids, NSP NSP or dietary fibre is the nam...

NSP NSP or dietary fibre is the name given to a group of materials found in the cell walls of plants which gives the plant its structure and form. Food hydrocolloids Fo

Infectious bovine rhinotracheitis (ibr), Infectious bovine rhinotracheitis ...

Infectious bovine rhinotracheitis (IBR) The disease is caused by a Bovine Herpesvirus -I belonging to the family Herpesviridae and subfamily Alphaherpesvirinae. It is a DNA vir

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Precautions used during a fever in a human, During a fever in a human  ...

During a fever in a human   A.  shivering may occur when the actual body temperature is lower than the set point for body temperature during the fever.   B.  there is an inc

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd