Agro industrial-cobalt, Biology

Assignment Help:

Cobalt
Cobalt functions as a component of vitamin B12  (cobalamin). Ruminants are not dependent on a dietary source of vitamin B12  because ruminal microorganisms can synthesize B12 from dietary cobalt. The amount of dietary cobalt converted to vitamin B12 in the rumen has ranged from 3 to 13 % of intake. Supplementation of cobalt in the diet is known to increase the synthesis of ruminal vitamin B12.


Related Discussions:- Agro industrial-cobalt

What is the endocrine function of the placenta, What is the endocrine funct...

What is the endocrine function of the placenta? The placenta is not a permanent gland of the endocrine system but it also has endocrinal function. The placenta produces estroge

Interior of the ventricles - heart, Each ventricle has an inflow part begin...

Each ventricle has an inflow part beginning just in front of the corresponding atrioventricular orifice and running forwards to the left towards the apex of the heart. The cavity t

What are vitamins, What are vitamins? What are the main vitamins needed by ...

What are vitamins? What are the main vitamins needed by humans? Most vitamins are coenzymes (fundamental substances for the enzyme functioning) that are not formed by the organ

The denver development screening test (ddst), THE DENVER DEVELOPMENT SCREEN...

THE DENVER DEVELOPMENT SCREENING TEST (DDST) The Denver Development Screening Test is a standardized test to assess gross motor, fine motor, language and social development

Name the material used in bioinert, Bioinert Metals:-  Commercially pur...

Bioinert Metals:-  Commercially pure titanium/ titanium alloys Ceramics:-  Aluminum oxide, zirconium oxide

Natality - population parameters and regulation, Natality - Population Para...

Natality - Population Parameters and Regulation Natality is the ability of a population to increase. Natality rate is equivalent to birth rate which means the production of ne

What is waterston shunt in palliative operations, What is Waterston Shunt i...

What is Waterston Shunt in palliative operations? In this, direct anastomosis between the posterior aspect of ascending aorta and anterior aspect right pulmonary artery is done

Define the swab or agar - food microbiology, Define the Swab or Agar - Food...

Define the Swab or Agar - Food Microbiology? Slant Method The method involves sampling with cotton swabs that are transferred directly to slants. Other methods include use of u

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd