Advantage of using the regulatory strategy of enzyme, Biology

Assignment Help:

You have two enzymes, 1 and 2. Both convert substance A into substance B. 1 is inhibited by B, because B partially blocks the active site and will not allow more A to enter. 2 is inhibited by a third substance, C, which binds to the back of 2 and changes its shape so that A cannot bind to the active site.

a. What type of inhibitor is B?

b. What type of inhibitor is C?

c. What is one advantage of using the regulatory strategy of enzyme 1 compared to enzyme 2?

d. What is one advantage of using the regulatory strategy of enzyme 2 compared to enzyme 1?


Related Discussions:- Advantage of using the regulatory strategy of enzyme

Explain three basic sexual life cycles studied in biology, What are the thr...

What are the three basic sexual life cycles studied in Biology? Which of them corresponds to metagenesis? Which of them is the human life cycle? Sexual reproduction may take pl

Lungs - respiratory organs, Lungs - Respiratory Organs In arachnid art...

Lungs - Respiratory Organs In arachnid arthropods such as scorpion and spider, respiration takes place by means of book lungs. There are four pairs of these structures in the

Spreading mechanisms of the disease, Talk about briefly three  of the commo...

Talk about briefly three  of the common enteric diseases caused by inadequate clean water supply and insufficient sanitation facilities. Your talk should contain the source and spr

Determine the significance of mesoglea, Determine the significance of Mesog...

Determine the significance of Mesoglea. The jellylike layer found between endodermal and ectodermal cell layers of diploblastic organisms. It acts as a type of cement holding t

System that permits movement and fixation to echinoderms, What is the syste...

What is the system that permits movement and fixation to echinoderms? The system that allows movement and fixation to substrates in echinoderms is known as the ambulacral syste

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

1408 final exam Eastfield University, I need the Answers for the final exam...

I need the Answers for the final exam for biology it''s a one hundred question test if you can help i would appreciate it

Which the phylum echinodermata is divided, Q. What are the classes into whi...

Q. What are the classes into which the phylum Echinodermata is divided? The five echinoderm classes are: asteroids (starfishes), ophiuroids, crinoids, holothuroids (sea cucumbe

Explain amylase, Amylase The presence of pancreatic amylase brings abou...

Amylase The presence of pancreatic amylase brings about  the breakdown  of starch  and glycogen and  its action is similar to salivary amylase. The hydrolysis of  starch and gl

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd