Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
You have two enzymes, 1 and 2. Both convert substance A into substance B. 1 is inhibited by B, because B partially blocks the active site and will not allow more A to enter. 2 is inhibited by a third substance, C, which binds to the back of 2 and changes its shape so that A cannot bind to the active site.
a. What type of inhibitor is B?
b. What type of inhibitor is C?
c. What is one advantage of using the regulatory strategy of enzyme 1 compared to enzyme 2?
d. What is one advantage of using the regulatory strategy of enzyme 2 compared to enzyme 1?
procees of excretion in reptiles
What are the three basic sexual life cycles studied in Biology? Which of them corresponds to metagenesis? Which of them is the human life cycle? Sexual reproduction may take pl
Lungs - Respiratory Organs In arachnid arthropods such as scorpion and spider, respiration takes place by means of book lungs. There are four pairs of these structures in the
Talk about briefly three of the common enteric diseases caused by inadequate clean water supply and insufficient sanitation facilities. Your talk should contain the source and spr
Determine the significance of Mesoglea. The jellylike layer found between endodermal and ectodermal cell layers of diploblastic organisms. It acts as a type of cement holding t
What is the system that permits movement and fixation to echinoderms? The system that allows movement and fixation to substrates in echinoderms is known as the ambulacral syste
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
I need the Answers for the final exam for biology it''s a one hundred question test if you can help i would appreciate it
Q. What are the classes into which the phylum Echinodermata is divided? The five echinoderm classes are: asteroids (starfishes), ophiuroids, crinoids, holothuroids (sea cucumbe
Amylase The presence of pancreatic amylase brings about the breakdown of starch and glycogen and its action is similar to salivary amylase. The hydrolysis of starch and gl
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd