Acute and chronic tonsilitis, Biology

Assignment Help:

Acute and Chronic Tonsilitis:

Tonsilitis refers  to the inflammation of  tonsils and lymphatic tissue that are located on each side of oropharynx. Acute infection of  tonsils usually occurs as a complication of pharyngitis and is usually caused by bacteria mainly; streptococcus, staphlococcus,  ' H. Influenzae and pneumococcus. It may also be caused by virus. Chronic tonsilitis results from recurrent infection. 

Pathophysiology 

As a result of  inflammation the tonsils. palatine or fauces enlarge, with the result they obstruct the airway and food passages. If  adenoids are also involved, they may block posterior nares resulting in mouth breathing. The eustachian tubes may also get blocked which may lead to otitis media. 

Medical Management 

If  throat culture shows B haemolytic streptococici then antibiotic are given for 8-10 days and child is followed up. 

Surgical Management 

Surgical management includes removal of  the tonsils which is a controversial issue 

Assessment 

You will find that the child with tonsilitis presents with mild to severe sore throat, fever, muscle aches, chills, dysphagia, pain in the ears, headache, anorexia and malaise. Inspection of  the tonsils reveal swelling and redness with pus. There may be yellow or white exudate over the tonsils. The uvula may be edematous and inflammed. The cervical lymphnodes are usually tender.  This includes evaluation of child for history of evidence of  allergic symptoms, recurrent respiratory infections and for symptoms of upper air way obstruction affecting respiration. You also need to assess the child by examining/inspecting mucosal lining of nares, appearance of  tonsils which are inflammed and enlarged, nature of  respiration and serous otitis media. 

Diagnostic evaluation includes, complete blood count which reveals elevated white blood cell count, throat culture and sensitivity and chest X-ray if respiratory  


Related Discussions:- Acute and chronic tonsilitis

Nutrition, type of nutrition in platypus and ant eater

type of nutrition in platypus and ant eater

Aortic valve replacement-types of surgery in ar, Aortic Valve Repla...

Aortic Valve Replacement :  Technique: Surgical technique is not much different from what has already been described for aortic stenosis. Care must be taken to avoid VF

What is juvenile mitral stenosis, Q. What is Juvenile Mitral Stenosis ? ...

Q. What is Juvenile Mitral Stenosis ? Peculiar to developing countries is the problem of juvenile mitral stenosis. Patients with rheumatic fever develop tight mitral stenosis i

Explain isomer, Isomer : Existence of different  compounds having  same ...

Isomer : Existence of different  compounds having  same  molecular form but different structural forms.

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Objectives of the earth pressure and retaining structures, What are the obj...

What are the objectives of the earth pressure and retaining structures? After knowing all concepts about the same you should be able to learn: a. Know the field situations w

What is the turnover number of the enzyme, Hydrolytic driving force. The hy...

Hydrolytic driving force. The hydrolysis of pyrophosphate to orthophosphate is important in driving forwards biosynthetic reactions such as the synthesis of DNA. THis hydrolytic re

Explain about the soil morphology, Explain about the Soil morphology S...

Explain about the Soil morphology Soil morphology is the description of the soil body and its general characteristics. The morphology of the soil is expressed by number, kinds

Protective role and metal chelating ability - nicotinic acid, Define Protec...

Define Protective role and Metal chelating ability? Protective role: Nicotinic acid is vital to the normal functioning of the skin intestinal tract and nervous system. It p

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd