Acetylcholine, Biology

Assignment Help:

Acetylcholine is the chemical released at neuromuscular junctions which binds to receptors on the surface of the plasma membrane of the muscle cells, creating an electrical impulse to be transmitted. The impulse ultimately leads to the muscle contraction.


Related Discussions:- Acetylcholine

Adaptive mechanisms, The adaptive mechanisms may be short term ones which c...

The adaptive mechanisms may be short term ones which come into play within minutes or hours of the onset of myocardial dysfunction. These are: Frank-Starling Mechanism In

Help with science question, In many animals, glucose, rather than starch, ...

In many animals, glucose, rather than starch, is transported by the blood through the body to all the cells. Starches in many foods are digested to yield glucose. Why is the digest

Procedures related to hygenic care, PROCEDURES RELATED TO HYGENIC CARE ...

PROCEDURES RELATED TO HYGENIC CARE Would you like to remain without a bath on any given day? Do you remain without a bath when you are sick.? No one normally, would like to m

Define vitamin a, Define Vitamin A, Iron and Zinc required for elderly? ...

Define Vitamin A, Iron and Zinc required for elderly? Vitamin A, Iron and Zinc: The recommendation for iron is said to decrease in elderly women. Intake of vitamin E and zinc

Determine the sarcomere of a skeletal muscle, In the sarcomere of a skeleta...

In the sarcomere of a skeletal muscle, there are A. myosin molecules in the I band. B. both tropomyosin and myosin molecules in the region of the A band that is not in the H

State about led fredrick griffith, In the experiments that led Fredrick Gr...

In the experiments that led Fredrick Griffith to discover the "Transforming Principle", which of the following was the key step in illustrating that a substance within one cell cou

Explain the objectives of congenital heart disease, Explain the Objectives ...

Explain the Objectives of Congenital Heart Disease ? After reading this unit, you should be able to: 1 Comprehenced the epidemiologic significance of congenital heart disease (

What is rationale for menu planning, What is Rationale for Menu Planning? ...

What is Rationale for Menu Planning? 'Menu', as we all know, is nothing but a list of dishes planned for preparation, and forms the very core of all activities in the food serv

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What is the dental implants option, Dental implants option It is import...

Dental implants option It is important that the type of prosthetic options selected for the patient is not only cost effective, but also must  be predictable and restores the e

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd