Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Ablation experiment is an experiment designed to produce an animal deficient in one or the few cell types, in order to study cell lineage or the cell function. The logic is to make a transgenic mouse with a toxin gene (often known as diphtheria toxin) under control of a specialized promoter which activates only in the target cell type. When the embryo development progresses to the point where it starts to form the target tissue, the toxin gene is activated, and that particular tissue dies. Other tissues are not affected.
Differance between pulsus bigerniny or trigeminy and presence of bruit ? Pulsus bigerniny or trigeminy: After every 2nd or 3rd beat respectively there will be a longer inter
Advantages and disadvantages of protozoa
Two parents who are each known to be carriers of an autosomal recessive alleles have four children. None of the children has the recessive condition. What is the probability that o
Undescended Testes (Cryptorchidism) Undescended testes is a ccmmon disorder. It may be unilateral and may be classified as ectopic cryptorchidism, when the testes are normal
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. Illustrate Hypertrophic cardiomyopathy? It is a genetic disorder due to mutations in the gene that encodes for β-Cardiac myosin heavy chain (Localised to chromosome 14). It
what so special for phylum annelida
True or false? It would be difficult to assess whether the drug-susceptible or drug-resistant phenotype in a population of Mycobacterium tuberculosis was more fit in an environment
Which type of genetic disease can be identified from the visual analysis of the number of chromosomes present in a karyotype? The counting and identification of chromosomes in
what is photo-respiration
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd