Ablation experiment, Biology

Assignment Help:

Ablation experiment is an experiment designed to produce an animal deficient in one or the few cell types, in order to study cell lineage or the cell function. The logic is to make a transgenic mouse with a toxin gene (often known as diphtheria toxin) under control of a specialized promoter which activates only in the target cell type. When the embryo development progresses to the point where it starts to form the target tissue, the toxin gene is activated, and that particular tissue dies. Other tissues are not affected.


Related Discussions:- Ablation experiment

Differance between pulsus bigerniny or trigeminy presence, Differance betwe...

Differance between pulsus bigerniny or trigeminy and presence of bruit ? Pulsus bigerniny or trigeminy: After every 2nd or 3rd beat respectively there will be a longer inter

Protozoa, Advantages and disadvantages of protozoa

Advantages and disadvantages of protozoa

What is the probability of a carrier of the recessive allele, Two parents w...

Two parents who are each known to be carriers of an autosomal recessive alleles have four children. None of the children has the recessive condition. What is the probability that o

Undescended testes (cryptorchidism), Undescended Testes (Cryptorchidism) ...

Undescended Testes (Cryptorchidism) Undescended testes is a ccmmon disorder. It may be unilateral and may be classified as ectopic cryptorchidism, when the testes are normal

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Illustrate hypertrophic cardiomyopathy?, Q. Illustrate Hypertrophic cardiom...

Q. Illustrate Hypertrophic cardiomyopathy? It is a genetic disorder due to mutations in the gene that encodes for β-Cardiac myosin heavy chain (Localised to chromosome 14). It

Phylum annelida, what so special for phylum annelida

what so special for phylum annelida

Whether the drug-susceptible or drug-resistant phenotype, True or false? It...

True or false? It would be difficult to assess whether the drug-susceptible or drug-resistant phenotype in a population of Mycobacterium tuberculosis was more fit in an environment

Which type of genetic disease can be identified, Which type of genetic dise...

Which type of genetic disease can be identified from the visual analysis of the number of chromosomes present in a karyotype? The counting and identification of chromosomes in

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd