A decrease in parasympathetic discharge to the heart, Biology

Assignment Help:

A decrease in parasympathetic discharge to the heart leads to

A. a decrease in the conductance of F-channels in SA node cells.

B. an increase in the conductance of potassium channels associated with muscarinic ACh receptors in SA node cells.

C. an increase in the amount of ACh (acetylcholine) released near SA node cells of the heart.


Related Discussions:- A decrease in parasympathetic discharge to the heart

What is electro osmosis , What is Electro osmosis ? Electro osmosis :...

What is Electro osmosis ? Electro osmosis :  Electroosmosis is the movement of charged molecules along a charged surfaces in response to a voltage difference. For example, e

What the pentose pathway supplies, With response to synthesis of fatty acid...

With response to synthesis of fatty acids and triacylglycerol, the pentose pathway supplies: -NADPH and glycerolaldehyde 3 P -NADPH and glucose -NADPH and ribulose 5 P

Determine the occurrence of folic acid, Occurrence of folic acid Folic...

Occurrence of folic acid Folic acid is an active principle widely  occurring in the animal and vegetable kingdom. Richest sources are liver, dark  green leafy vegetables, bean

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Differential reinforcement of other behaviour, Differential reinforcement o...

Differential reinforcement of other behaviour (DRO) This is used to decrease frequent behaviour by reinforcing any behaviour other than the undesired one. An instance would be r

What is muscle tissue explain briefly, What is Muscle tissue explain briefl...

What is Muscle tissue explain briefly? Remember that a skin cell, in addition to the genetic information that allows it to form into a skin cell, also has all of the genetic in

Adrenal medulla, ADRENA L MEDULLA The adrenal medulla develops from th...

ADRENA L MEDULLA The adrenal medulla develops from the neuroectoderm of the embryo. Medulla consists of chromaffin cells or phaeochromocytes. These cells are connected wi

Define proteolytic enzymes, Proteolytic enzymes They catalyze the hydro...

Proteolytic enzymes They catalyze the hydrolysis of peptide bonds in other proteins. In order to prevent them doing generalized damage to all cellular proteins, they are often

Define the herbals, Q. Define the Herbals? During the Middle Ages, foll...

Q. Define the Herbals? During the Middle Ages, following the decline of the Greek and Roman civilisations, little significant botanical progress was made. The early herbals (i.

What are ions, What are ions? What are the two types of molecules into whic...

What are ions? What are the two types of molecules into which ions are classified? Ions are atoms or substances electrically charged by means of loss or gain of electrons.

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd