Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
A decrease in parasympathetic discharge to the heart leads to
A. a decrease in the conductance of F-channels in SA node cells.
B. an increase in the conductance of potassium channels associated with muscarinic ACh receptors in SA node cells.
C. an increase in the amount of ACh (acetylcholine) released near SA node cells of the heart.
What is Electro osmosis ? Electro osmosis : Electroosmosis is the movement of charged molecules along a charged surfaces in response to a voltage difference. For example, e
With response to synthesis of fatty acids and triacylglycerol, the pentose pathway supplies: -NADPH and glycerolaldehyde 3 P -NADPH and glucose -NADPH and ribulose 5 P
Occurrence of folic acid Folic acid is an active principle widely occurring in the animal and vegetable kingdom. Richest sources are liver, dark green leafy vegetables, bean
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Differential reinforcement of other behaviour (DRO) This is used to decrease frequent behaviour by reinforcing any behaviour other than the undesired one. An instance would be r
What is Muscle tissue explain briefly? Remember that a skin cell, in addition to the genetic information that allows it to form into a skin cell, also has all of the genetic in
ADRENA L MEDULLA The adrenal medulla develops from the neuroectoderm of the embryo. Medulla consists of chromaffin cells or phaeochromocytes. These cells are connected wi
Proteolytic enzymes They catalyze the hydrolysis of peptide bonds in other proteins. In order to prevent them doing generalized damage to all cellular proteins, they are often
Q. Define the Herbals? During the Middle Ages, following the decline of the Greek and Roman civilisations, little significant botanical progress was made. The early herbals (i.
What are ions? What are the two types of molecules into which ions are classified? Ions are atoms or substances electrically charged by means of loss or gain of electrons.
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd