Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
NON-STARCH POLYSACCHARIDES A polysaccharide often termed as complex carbohydrate. Besides starch, a mixture of substances called non starch polysaccharide (NSP), also constitut
What is the valve that separates the stomach from the esophagus called? What is its function? The valve that separates the stomach from the esophagus is the cardia. It has the
Which type of genetic disease can be identified from the visual analysis of the number of chromosomes present in a karyotype? The counting and the identification of chromosomes
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
a) How do viruses enter plant body and spread to long distances within it? b) Mention any two ways by which viruses spread from single plant to another.
Tikka Disease in Groundnut
names and locatio
Define in brief about the Golgi bodies In a cell is achieved in a remarkable fashion by the Golgi bodies. The latter receive the newly synthesised proteins from the rough endop
What is the autotrophic hypothesis on the origin of life? The autotrophic hypothesis on the origin of life asserts that the first living beings on earth were producers of thei
Respiration – Protozoan Gas exchange occurs by the diffusion of oxygen across the cell membrane. Some protozoan utilize this oxygen but are also capable of anaerobic respirati
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd