Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
It is the process of separating colloidal and suspended impurities from water by passing it through a porous bed made of fine sand and other proper sized granular materials. Filtration is carried out in a sand filter. It consists of a top thick layer of fine sand, placed over coarse sand layer followed by gravel. Water comes from the top.
Small micro-organisms present in sand voids decompose organic matter and remove some of the biological impurities.
Q. What is Short Bowel Syndrome? Short bowel syndrome is a group of problems affecting people who have /had half or more of their small intestine removed. The massive resection
Define the Determination of Completion of Reaction ? Several methods are used to determine when the reaction is complete. Some of these include (a) Observing an indicator (c
Q. How do the potassium and sodium ions maintain the resting potential of the neuron? The plasma membrane of the neuron when at rest maintains an electric potential difference
Q What are the three periods into which interphase are divided? Interphase is the preceding phase to the mitotic division. It is divided into three periods, G1, S and G2 the le
Determine Push-ups Test for check the Body Strength? Push-ups is another test done to measure muscular strength, as well as, endurance and done on a parallel bar. The subject
Q. Investigations process of constrictive pericarditis? Electrocardiogram Low voltage complexes can occur. Left atrial enlargement may be seen. Atrial fibrillation occu
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. What is the homeostasis? What are the sensors, effectors and controllers of homeostasis? Homeostasis comprises the processes by which the organism maintains extracellular an
Q. How to calculate glycemic index? If you take a certain rood and measure the rise in blood sugar in response to the food consumed in comparison with the response to an equal
Show History of Quantitative Impacts on Biology Quantitative threads have been woven into the fabric of biology since at least the late 19th century, when Malthus warned of the
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd