filtration, Biology

Assignment Help:

It is the process of separating colloidal and suspended impurities from water by passing it through a porous bed made of fine sand and other proper sized granular materials. Filtration is carried out in a sand filter. It consists of a top thick layer of fine sand, placed over coarse sand layer followed by gravel. Water comes from the top.

Small micro-organisms present in sand voids decompose organic matter and remove some of the biological impurities. 

 

 


Related Discussions:- filtration

Toxic agents present in which food, Toxic agents present in food which inte...

Toxic agents present in food which interfere with thyroxine synthesis lead to the development of: 1. toxic goitre 2. cretinism 3. simple goitre 4. thyrotoxicosis si

Organic chemistry and macromolecules, identify 7 speccific ways in which yo...

identify 7 speccific ways in which you can diversify carbon-containing compounds

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Golgi complex, Golgi complex is the organelles in animal cells having a se...

Golgi complex is the organelles in animal cells having a sequence of þattened sacs which sort, chemically modify, and package proteins produced on the rough endoplasmic reticulum.

State the stabilization of haem pigments, State the Stabilization of haem p...

State the Stabilization of haem pigments Ligands suggested for the stabilization of haem pigments are imidazole (and its derivatives), S-nitrosocysteine and nitrite. Whereas se

What do you mean by subxiphoid long axis sweep, Q. What do you mean by Subx...

Q. What do you mean by Subxiphoid Long Axis Sweep? This sweep begins with keeping the transducer at subxiphoid region, positioning directly posterior with marker pointing towar

Define etiological risk factors in cancer, Define Etiological Risk Factors ...

Define Etiological Risk Factors in Cancer? Cancer risks are climbing because of increasingly sedentary lifestyles and diets which are high in fat and sugar although low in frui

Non-modifiable risk factors for coronaru heart diseases, Q. Non-Modifiable ...

Q. Non-Modifiable Risk Factors for coronaru heart diseases? Non-Modifiable Risk Factors 1. Age 2. Sex 3. Heredity 4. Endomorphic Body Build Family history: Pe

Explain types known in metabolic pathways, How many regulatory enzyme types...

How many regulatory enzyme types known in metabolic pathways, explain in detail by giving examples.

Three and four kingdom classification, Three and Four Kingdom Classificatio...

Three and Four Kingdom Classification The two-kingdom classification, while solving many of the problems of classification, failed to establish clear-cut distinction between p

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd