Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
α- amylase activity by GA3 - Dormancy
Of the enzymes required for the digestion of starch α-amylase appears immediately after the start of germination. It was found that if the embryo was removed no a-amylase appeared, however, if very low concentations of GA3 were added to the seed the production of digestive enzyme proceeds. The work over the last 30 years proved the fact that GA3 initiates action at transcriptional and translational levels. Not only activation of pre-existing m-RNAs coding for a-amylase but synthesis of m-RNA also takes place after the exposure of seeds to GA3.
Cytokinins and Cell Division
Cell division involves synthesis of new DNA, RNA and a host of cell proteins in interphase (cell cycle S1 and S2). All these events are promoted by cytokinins. Cell division also means synthesis of a number of enzymes that are needed for the synthesis of cell wall and middle lamella.
FUNCTION S OF TESTOSTERONE - (a) It stimulates the growth and development of male secondary sex organs like the seminal vesicles, prostate and penis. It also helps to maintain
steps of digestive system in amoeba,with a clear picture description
Discuss how the blood sugar level is maintained at a stable level in the well fed and fasting state In the fed state, clearance of blood glucose is mainly by liver via gluc
Electro magnetic radiation Light is one form of energy. The light rays consist of tiny particles called photons. The energy carried by photon is called quantum. Light
How do i use the factor-label method to calculate the number of grams of KMnO4 that you would need to make 100 ml of a 0.0045 M potassium permanganate solution? Be sure to show all
Q. Does pH affect the enzyme activity? The concentrations of hydrogen ions in solution affect the enzyme activity. Each enzyme has utmost efficiency under an optimum p H . S
Cognitive - Behavioural Approaches They includepsychoeducatiorzal and rational-emotive therapy. The goal is to identify problem behaviour and irrational beliefs and then to de
what is .groups of protozoa?
Leghaemoglobin - Factors Influencing Functions of Nitrogenase Leghaemoglobin is a joint product of Rhizobium and the host. It is produced during the maturation of nodule. It i
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd