., Biology

Assignment Help:
what is nuclus

Related Discussions:- .

Sublimation-evaporation-transpiration-water cycle , Sublimation is the pr...

Sublimation is the process by which solid water changes directly to vapour phase without passing through the intervening liquid phase. The gradual disappearance of flakes of ice

Explain cancer and inhibition of tumorigenesis, Explain Cancer and Inhibiti...

Explain Cancer and Inhibition of Tumorigenesis? Polyphenols appear to play a preventive role although the molecular mechanisms of action and applicability to human cancer preve

Immediate cardiac care (24- 72 hours) after operation, Immediate Care (24...

Immediate Care (24- 72 hours) All monitoring and medications continued. Flushing of arterial lines are done at regular intervals with heparin flush as well as whenever art

Poultry and duck diseases-marek''s disease, Marek's disease Marek's dis...

Marek's disease Marek's disease is a lymphoproliferative disease of chicken, quails, bantams and other free-flying birds. It is caused by the Gallid Herpesvirus 2 of subfamily

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What is ascending aortic aneurysm, What is Ascending Aortic Aneurysm ? ...

What is Ascending Aortic Aneurysm ? Ascending Aortic Aneurysm :  In aneurysms confined to ascending aorta well below the innominate artery origin, the technique used is

What is the original concentration, A sample of yeast cells was serially di...

A sample of yeast cells was serially diluted 1/10 five times then serially diluted 1/3. the number of yeasts was338 yeasts per ml. what was the original concentration? Please show

Epidemiology, The epidemiology of acute rheumatic fever (ARF) is closely co...

The epidemiology of acute rheumatic fever (ARF) is closely connected with that of group-A beta haemolytic streptococcal pharyngitis, both have a maximum incidence in the age group

Temperature regulation in homeotherms, Temperature Regulation in Homeotherm...

Temperature Regulation in Homeotherms Homeothermy is regulation of body temperature by physiological means. The stabilisation of body temperature permits a steady high level

Frequency - synthetic characters, Frequency - Synthetic Characters Thi...

Frequency - Synthetic Characters This term refers to the degree of dispersion of individual species in an area, and is usually expressed in terms of percentage. Frequency can

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd