Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
When a fatty acid reacts with glycerol, the result is- Select one: a. Formation of an amide b. Formation of an ester c. Formation of hydrocarbon d. Formation of a th
Explain the gradient theoryof experimental embryology
What is the meaning of Obesity? Obesity is a condition resulting from accumulation of excess body fat. The fat deposition takes place because over a period of time, people cons
Food Applications of Carrageenan Carrageenan consists of a family of hydrocolloids, which have different properties and it has a wide variety of uses. Some examples of properti
Dinoflagellates are single-celled to colonial protistans characterized by the two flagella, one girdling cell and the other trailing the cell. Some of the dinoflagellates exist in
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
A diploid cell contains: A.one half of a complete set of chromosomes B.several complete sets of chromosomes C.the correct number of chromosomes D.two complete sets of chromosomes E
Define Carbohydrates needs in Postoperative Nutritional Care? Carbohydrates ensure the use of protein for tissue synthesis and energy required for increased metabolic demands.
Dicots are one of the two main types of flowering plants; characterized by having two cotyledons, floral organs arranged in the cycles of four or five, and leaves with the reticul
Why must our cells duplicate the DNA molecules before they divide in Mitosis? Why do chromosomes condense by wrapping around the histone protiens durning the cell cycle?
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd