Reference no: EM13969052
I. A double strand of DNA contains the following sequence. 5' AGTAGGTTTACACTGCTGCCCCACTATCGTATCTTCCCTGAGTGAGCATTG 3'
3' TCATCCAAATGTGACGACGGGGTGATAGCATAGAAGGGACTCACTCGTAAC 5'
a. Write the 6 reading frames and group nucleotides in codons, i.e. GTACGT= GTA CGT.
b. From the 6 reading frames, is there an open reading frame (ORF)? If yes, which reading frame? Please indicate the start and stop codons in different colors.
II. Review blue-white screening in the website below: https://highered.mcgraw-hill.com/sites/0072556781/student_view0/chapter14/animation_quiz_2.html
You are cloning human insulin gene (INS) in the lab using a plasmid, pJET, that contains an ampicillin resistance marker and also a lacZ gene interrupted by a multiple cloning site. You transform the rDNA into competent E. coli cells by electroporation, then plated the transformed E. coli on agar plates containing ampicillin and X-Gal and waited one day until colonies are visible. You then use blue/white screening to help you identify clones that carry INS gene. You observe numerous blue and white colonies on the agar plate.
a. What do blue colonies signify? Briefly explain your answer.
b. Which colonies (blue, white, or both) would you want to pick for further analysis to check for the successful cloning of the INS gene? Briefly explain your answer.
c. If you forgot to add X-gal to the agar selection medium, how would the colonies that grow differ phenotypically from the ones that grow in plates with X-Gal? Briefly explain your answer.
d. If you forgot to add ampicillin to the agar selection medium, what other colonies would grow that won't normally grow in plates with ampicillin? What color would those other colonies most likely be?
|
Define the terms labor relations and labor unions
: Define the terms Labor Relations, Labor Unions, and Collective Bargaining; what is the collective bargaining process?
|
|
Total quality management programs
: Which of the following steps should a company's plan of action for a crisis include? Which of the following allows a company to conduct a presentation in real time over the Internet simultaneously with a conference telephone call? In Total Quality Ma..
|
|
Management effectively communicate this change to employees
: A company is faced with the challenge of communicating to its employees a significant change in its policies. How should the management effectively communicate this change to its employees? Which of the following is true of resignation messages? To a..
|
|
Develop worldview integrative activities
: How can a teacher begin to develop worldview integrative activities into the curriculum regardless of whether they teach in a Christian, private, or public school setting
|
|
Write the six reading frames and group nucleotides in codons
: Write the 6 reading frames and group nucleotides in codons, i.e. GTACGT= GTA CGT. From the 6 reading frames, is there an open reading frame (ORF)? If yes, which reading frame?
|
|
A procedural message is most effective when
: Darren was asked to document a research paper as part of his final examination. The assignment needed weeks of careful study and experimentation before submission. Angela needs to produce a graphic for her employees that depicts the process of handli..
|
|
Voice input and output technology
: When Jack tried calling Steve, he received a pre recorded message requesting him to leave. While employment videos are helpful in communicating a person’s qualifications and abilities, their use may also: Voice input and output technology:
|
|
Difference between connotative words and denotative words
: Which of the following is a difference between connotative words and denotative words? Laurent is being interviewed for the position of content analyst at Alping Inc. Zara, the interviewer, asks Laurent to tell her about a time when Laurent was able ..
|
|
Explain the differences between use abuse and addiction
: Explain the differences between use, abuse and addiction/dependence. Signs and Symptoms of Addiction (Use DSM and ASAM definitions). Describe the physical and psychological features of addiction/dependency.
|