Write the sequence of the primary rna transcript

Reference no: EM1396236

Below is a segment of bacterial Lac Operon sequence. An E. coli transcript with the first 5 nucleotides 5' AUGU3'. Carefully examine the sequence and then answer the questions.
Strand A: 5'GCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAAGTTAATCACACAGGAAACAGCTATGACCATGATT 3'
Strand B: 3'CGAAATGTGAAATACGAAGGCCGAGCATACAACACACCTTAACACTCGCCTATTCAATTAGTGTGTCCTTTGTCGATACTGGTACTAA 5'
A. Where is the trascription start site?
B. find TTTACA around -35 region and box it. (my answer is highlighted in yellow above)
C. find TATGTT around -10 region and box it. (my answer highlighted pink above)
D. lable template and coding strands (my answer: template is strand B and coding is strand A)
E. does transcription elongation proceed towards the right or left? (my answer: right)
F. write the sequence of the primary RNA transcript starting at 5' aUUGU3'. include polarity of the transcript.

Reference no: EM1396236

Questions Cloud

Determining an overbooking policy : Suppose which from experience you know the probabilities of specific numbers of no-shows. Could you use which information in determining an overbooking policy?

Sample of round-trip discount fares : In the year 2006 the mean fare to fly from Charlotte, North Carolina, to Seattle, Washington, on a discount ticket was $267. A random sample of round-trip discount fares on this route last month gives:

Multiple regression analysis-airplane passengers : The demand for airplane passengers (Y) is a function of a average fare (X1), the fare of the competing airline, and the annual per capital income of the passengers(X3)

Explain how rapid evolution could help a species : Explain how rapid evolution could help a species cope with and thrive in new or changing environment. please do not post links to answers or copy and paste super long answers.

Write the sequence of the primary rna transcript : Below is a segment of bacterial Lac Operon sequence. An E. coli transcript with the first 5 nucleotides 5' AUGU3'. Write the sequence of the primary RNA transcript starting at 5' aUUGU3'. include polarity of the transcript.

Explain the extent to which leader cares about subordinates : Explain the extent to which the leader cares about subordinates, respects their ideas and feelings, and establishes mutual trust.

Show the genotypes of the p, f1 and f2 generations : Wild-type fruit flies have brick-red eyes. A pure-breeding strain of wild-type flies was crossed with a pure-breeding strain with white eyes.

Logic of the ordinary least square : Explain the logic of the ordinary least Square (OLS) method? How are the least squares formulas for the slope and intercept derived?

What is the likely origin of the recombinants : In peas, the genes a, b, c, d, e and f are linked on chromosome V and in the order given and the map distances are RF(a-b)=7 cM, RF(b-c) = 17 cM, RF(c-d) = 12 cM, RF (d-e) = 14 cM RF(e-f)= 10 cM.

User Account

All Pages