Write the sequence of the primary rna transcript

Assignment Help Biology
Reference no: EM1396236

Below is a segment of bacterial Lac Operon sequence. An E. coli transcript with the first 5 nucleotides 5' AUGU3'. Carefully examine the sequence and then answer the questions.
Strand A: 5'GCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAAGTTAATCACACAGGAAACAGCTATGACCATGATT 3'
Strand B: 3'CGAAATGTGAAATACGAAGGCCGAGCATACAACACACCTTAACACTCGCCTATTCAATTAGTGTGTCCTTTGTCGATACTGGTACTAA 5'
A. Where is the trascription start site?
B. find TTTACA around -35 region and box it. (my answer is highlighted in yellow above)
C. find TATGTT around -10 region and box it. (my answer highlighted pink above)
D. lable template and coding strands (my answer: template is strand B and coding is strand A)
E. does transcription elongation proceed towards the right or left? (my answer: right)
F. write the sequence of the primary RNA transcript starting at 5' aUUGU3'. include polarity of the transcript.

Reference no: EM1396236

Questions Cloud

Determining an overbooking policy : Suppose which from experience you know the probabilities of specific numbers of no-shows. Could you use which information in determining an overbooking policy?
Sample of round-trip discount fares : In the year 2006 the mean fare to fly from Charlotte, North Carolina, to Seattle, Washington, on a discount ticket was $267. A random sample of round-trip discount fares on this route last month gives:
Multiple regression analysis-airplane passengers : The demand for airplane passengers (Y) is a function of a average fare (X1), the fare of the competing airline, and the annual per capital income of the passengers(X3)
Explain how rapid evolution could help a species : Explain how rapid evolution could help a species cope with and thrive in new or changing environment. please do not post links to answers or copy and paste super long answers.
Write the sequence of the primary rna transcript : Below is a segment of bacterial Lac Operon sequence. An E. coli transcript with the first 5 nucleotides 5' AUGU3'. Write the sequence of the primary RNA transcript starting at 5' aUUGU3'. include polarity of the transcript.
Explain the extent to which leader cares about subordinates : Explain the extent to which the leader cares about subordinates, respects their ideas and feelings, and establishes mutual trust.
Show the genotypes of the p, f1 and f2 generations : Wild-type fruit flies have brick-red eyes. A pure-breeding strain of wild-type flies was crossed with a pure-breeding strain with white eyes.
Logic of the ordinary least square : Explain the logic of the ordinary least Square (OLS) method? How are the least squares formulas for the slope and intercept derived?
What is the likely origin of the recombinants : In peas, the genes a, b, c, d, e and f are linked on chromosome V and in the order given and the map distances are RF(a-b)=7 cM, RF(b-c) = 17 cM, RF(c-d) = 12 cM, RF (d-e) = 14 cM RF(e-f)= 10 cM.

Reviews

Write a Review

Biology Questions & Answers

  Immune response to infectious disease

It is a very curcial concept to understand how the immune response is mounted against viruses, bacteria, protozoans and helminthes. For an effective immune response, both innate and adaptive immunity should work together.

  A review on advanced glycated end products (ages)

This Project report elaborates a critical review of important elements attached to Advanced Glycated End Products (AGEs). It is very crucial to understand the process called Millard reaction.

  Plastic as a soil stabilizer

Soil stabilization is the permanent physical and chemical alteration of soils to enhance their physical properties. Stabilization can increase the shear strength of a soil and control the shrink-swell properties.

  Principles of microbiology

This assignment has three parts which contains questions related to Microbiology. It contains basic principles of microscopy, staining techniques in microbiology and microbial growth in the food industry.

  List the biologic functions

Lipid metabolites are often seen as key elements in cellular signaling. Is this unique? Please provide several examples of the function of lipids as key elements in signal arrays and list the biologic functions these signals affect?

  Biologic function relationships

Please describe how one might search for chemical structure, biologic function relationships, involving small molecular weight lipophylic compounds. Provide one example.

  Case study on patient in the haematology laboratory

Write a case study which detailing a scenario of a patient being investigated in the Haematology laboratory.

  Use of pcr and genetic approaches in biotechnology

The use of PCR and genetic approaches in biotechnology

  Describe the role of this enzyme in honey

Glucose oxidase is an enzyme that can be used for measurements of glucose levels by combining this reaction with an oxygen probe.

  Genetic problems

What phenotypic ratio would you get if you crossed a white mouse and a heterozygous brown mouse?

  Prepare an essay on nosocomial infection

Prepare an essay on nosocomial infection.

  Monitoring and recording the blood pressure

To increase the awareness of monitoring and recording the blood pressure of patients and practice measuring blood pressure in a safe environment.

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd