Write the code segment needed to set the data variable

Assignment Help Basic Computer Science
Reference no: EM13307684

Given the following declarations:
struct Example {
int data;
char *tag;
};
struct Example *example;
Write the code segment needed to set the data variable to 25, and the tag string to "Hello World".

Reference no: EM13307684

Questions Cloud

Determine what volume of naocl will be needed : An electric power plant consumes 2.5 million gallons per day of cooling water. To control bacterial growth (slime), 2.0 mg/L of chlorine (measured as Cl2) is injected into the make-up water fed to the system.
Find the focal length of the objective : The objective lens in a microscope with a 25.0 cm long tube has a magnification of -50.0 and the eyepiece has a magnification of20.0. What is the focal length of the objective
What are the final values of m and n : what are the final values of m and n if all parameters of f(x,y,and z) are passed by.
What is the magnitude of the net electrostatic force : A particle of charge 1.2mC is located 1mm inside of uniform charge of 3.2mC that has an inner radius of 5.0cm, What is the magnitude of the net electrostatic force on the particle
Write the code segment needed to set the data variable : Write the code segment needed to set the data variable to 25, and the tag string to "Hello World".
Provide the engineering judgement to justify the shipment : The pressure inside the cylinder is 50 atm and temperature is 298o K. Provide your engineering judgement (with calculations) to justify or not justify the shipment of the cylinder.
Define a function that takes argument in name of a csv file : Define a function that takes an argument in the name of a CSV file. This file can have any number of rows. Each row has exactly 10 words separated by comma. Your function should print the total number of four letter words in the file.
What would the first allowed orbital be for a particle : What would the first allowed orbital be for a particle whose mass is 2 x 10 ^ -39 kg and velocity was 30% the speed of light
Write a program that accepts as input a number of oranges : Write a program that accepts as input a number of oranges and produces as output the minimum baseline requried at the lowest level so that all of these oranges can be included in this stack. The number of oranges is always a positive integer.

Reviews

Write a Review

Basic Computer Science Questions & Answers

  Write a procedure that updates all the payment dates

Write a procedure that updates all the payment dates to the current date + 10 days for a given student (name) in the invoice table using cursors. (Will you need a schema? How do i send it to you ? do you need just the tables for the student and th..

  Write a program that prompts the user to input a string

Write a program that prompts the user to input a string and then outputs the string in the pig Latin form. The rules for converting a string into pig latin form are described in Programming example : Your program must store the characters of a str..

  Compare time complexity of convolution with kernel

Compare the time complexity of convolution with a n x n kernel when using: direct convolution with the 2-D mask, and separable kernel.

  What are some ways that company''s can use to get the word

Security awareness programs are their so employees cannot make ignorance an excuse. What are some ways that company's can use to get the word out, and to make sure their employees cannot make that excuse?

  Determine independent variable and dependent variable

The length of the string is shortened by 5cm and the time is measured. Determine the independent variable? Determine the dependent variable? What must the controlled variables be?

  Write general set of instructions will allow us to change

Write a general set of instructions that will allow us to change any displayed value (from 0 to 9) to any desired value (from 0 to 9) in the least number of steps. For example, if the displayed value is 1 and the desired value is 0,

  Draw a 16 input sorter

Let "10 10 11 10 00 11 10 00" be your input. Draw a 16 input sorter that uses the divide-and-conquer idea of MergeSort. Show the values on each wire at intermediate steps (i.e. output after a half cleaner of 16 inputs).

  Creating cut-over plan for alternate processing site

Create cut-over plan for alternate processing site based on given below. Consider LAN for small 100-person business, Pixel Inc. Business occupies one floor in an office building.

  Identify position-indicate what pattern is found in thread

Thread the sequence AATCGATAAGCAAAACCGGATTACGATATATAT through the tree. If any pattern is found in any position, identify that position and indicate what pattern is found.

  Write a select statement that returns four columns

Write a Select statement that returns four columns from the Invoices table, named Number, Total, Credits, and Balance

  What is ntp and what are clock strata

 What is UTC and why is it used and what is NTP and what are "clock strata"?

  Tradeoffs involved to improve overall system performance

What are your thoughts on the tradeoffs involved when attempting to improve overall system performance. Provide examples where an increase in the performance of one resource.

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd