Write out the resulting m-rna

Reference no: EM133255813

TCTTCCCTCGCGCTCCTAAACGTTCAACCGGTTCAACTTAATCCGCCGCCAGGGCCCCGCCCCTCAGAAGTTGGTGATGCG

Question 1. Decode the above strand. Write out the resulting m-RNA.

Question 2. Divide the m-RNA into it's codons by placing a vertical line between them.

Reference no: EM133255813

Questions Cloud

Discuss three private sources of export assistance : Discuss three private sources of export assistance. What is the Gold Key Service? Explain the steps involved in a typical export transaction.

How would the surveillance methods you would employ : BIOLOGY University of Phoenix How would the surveillance methods you would employ in Myanmar be different that those you would employ in Uruguay?

What factors can influence someone response criterion : What does a negative C statistic mean? What does a positive C statistic mean? What factors can influence someone's response criterion?

Facts and background of client harris case : This assignment deals with a client of the law firm of P&K LLC. The client, Ms. Paula Harris retained P&K to represent her as plaintiff in a civil lawsuit resul

Write out the resulting m-rna : BIO 0848 Temple University Decode the above strand . Write out the resulting m-RNA and Divide the m-RNA into it's codons by placing a vertical line

Anthropologist about influences on work-life balance : What are two questions from each point of view of a psychologist, a sociologist, and an anthropologist about the influences on work/life balance?

Explain influences demand-regardless of price increase : Refer to the 9 NON-PRICE DETERMINANTS OF DEMAND. Explain how each influences demand, regardless of price increase or decrease.

Discuss the main standard the court : Discuss the main standard the court used in awarding child custody.

Demonstrates the relationship between percent germination : BIOL 3130 University of Houston, demonstrates the relationship between percent germination and salinity gradient (the graph should have only one (1) line on it)

User Account

All Pages