Write out the resulting m-rna

Assignment Help Biology
Reference no: EM133255813

TCTTCCCTCGCGCTCCTAAACGTTCAACCGGTTCAACTTAATCCGCCGCCAGGGCCCCGCCCCTCAGAAGTTGGTGATGCG

Question 1. Decode the above strand. Write out the resulting m-RNA.

Question 2. Divide the m-RNA into it's codons by placing a vertical line between them.

 

Reference no: EM133255813

Questions Cloud

Discuss three private sources of export assistance : Discuss three private sources of export assistance. What is the Gold Key Service? Explain the steps involved in a typical export transaction.
How would the surveillance methods you would employ : BIOLOGY University of Phoenix How would the surveillance methods you would employ in Myanmar be different that those you would employ in Uruguay?
What factors can influence someone response criterion : What does a negative C statistic mean? What does a positive C statistic mean? What factors can influence someone's response criterion?
Facts and background of client harris case : This assignment deals with a client of the law firm of P&K LLC. The client, Ms. Paula Harris retained P&K to represent her as plaintiff in a civil lawsuit resul
Write out the resulting m-rna : BIO 0848 Temple University Decode the above strand . Write out the resulting m-RNA and Divide the m-RNA into it's codons by placing a vertical line
Anthropologist about influences on work-life balance : What are two questions from each point of view of a psychologist, a sociologist, and an anthropologist about the influences on work/life balance?
Explain influences demand-regardless of price increase : Refer to the 9 NON-PRICE DETERMINANTS OF DEMAND. Explain how each influences demand, regardless of price increase or decrease.
Discuss the main standard the court : Discuss the main standard the court used in awarding child custody.
Demonstrates the relationship between percent germination : BIOL 3130 University of Houston, demonstrates the relationship between percent germination and salinity gradient (the graph should have only one (1) line on it)

Reviews

Write a Review

Biology Questions & Answers

  Immune response to infectious disease

It is a very curcial concept to understand how the immune response is mounted against viruses, bacteria, protozoans and helminthes. For an effective immune response, both innate and adaptive immunity should work together.

  A review on advanced glycated end products (ages)

This Project report elaborates a critical review of important elements attached to Advanced Glycated End Products (AGEs). It is very crucial to understand the process called Millard reaction.

  Plastic as a soil stabilizer

Soil stabilization is the permanent physical and chemical alteration of soils to enhance their physical properties. Stabilization can increase the shear strength of a soil and control the shrink-swell properties.

  Principles of microbiology

This assignment has three parts which contains questions related to Microbiology. It contains basic principles of microscopy, staining techniques in microbiology and microbial growth in the food industry.

  List the biologic functions

Lipid metabolites are often seen as key elements in cellular signaling. Is this unique? Please provide several examples of the function of lipids as key elements in signal arrays and list the biologic functions these signals affect?

  Biologic function relationships

Please describe how one might search for chemical structure, biologic function relationships, involving small molecular weight lipophylic compounds. Provide one example.

  Case study on patient in the haematology laboratory

Write a case study which detailing a scenario of a patient being investigated in the Haematology laboratory.

  Use of pcr and genetic approaches in biotechnology

The use of PCR and genetic approaches in biotechnology

  Describe the role of this enzyme in honey

Glucose oxidase is an enzyme that can be used for measurements of glucose levels by combining this reaction with an oxygen probe.

  Genetic problems

What phenotypic ratio would you get if you crossed a white mouse and a heterozygous brown mouse?

  Prepare an essay on nosocomial infection

Prepare an essay on nosocomial infection.

  Monitoring and recording the blood pressure

To increase the awareness of monitoring and recording the blood pressure of patients and practice measuring blood pressure in a safe environment.

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd