Write down sructured english for clyde-s narrative

Assignment Help Basic Computer Science
Reference no: EM1371449

Clyde Clerk is reviewing his firm's expense reimbursement policies with the new salesperson, Trav Farr. " Our reiimbursement policies depend on the situation. You seee, first we determine if it is located trip. If it is, we only pay mileage of 18.5 cents a mile. If the trip was a one-day trip, we pay mileage and then check the time of departure and return. To be reimbursed for breakfast, you must leave by 7:00am., luch by 11:00 am., and have diner by 5:00pm to receive reimbursement for breaakkfast, you mkust return later than 10:00am., luch later than 2:00pm., and have dinner by 7:00pm. On a trip lasting more than one day, we allow hotel, taxi, and airfare as well as meal allowances. The same times apply for meal expenses. "Write sructured English for Clyde's narrative of the reimbursement policies.

Reference no: EM1371449

Questions Cloud

Illustrate what ways could this situation affect party : Suppose major officeholders from one particular party are not performing well and party is not monitoring se officeholders. In illustrate what ways could this situation affect party as a whole.
Economic interplay-airline industry : Discuss how the interplay between economies of density and the properties of hub-and-spoke networks give rise to economies of scope.
Survival instinct or closed mind : When we consider how quickly we find out what is happening in Iraq and the rest of the world, we really have no excuse for being ignorant of the world and what is happening in it.
What is the velocity of the second skater : Two 3.5 kg bodies, A and B, collide. The velocities before the collision are A = (21 + 30) m/s and B = (-34 + 11) m/s. After the collision, ′A = (-4.5 + 16) m/s.
Write down sructured english for clyde-s narrative : On a trip lasting more than one day, we permit hotel, taxi, and airfare also meal allowances. Same times apply for meal expenses. Write down sructured English for Clyde's narrative of the reimbursement policies.
Discuss balance of fixed and variable costs for organization : Discuss balance of fixed and variable costs for organization. Explain how has Internet changed this balance for organizations.
How business is using the arts : Impress your instructors with a new way of looking at decision making and management methods. Learn what companies are using the arts.
Bureaucratic organizational structure : The bureaucratic form of government is so prevalent in public agencies and tends to result in a slower paced, less consumer oriented management
Explain resource scarcity influence hospice-palliative care : Explain how resource scarcity influence hospice/palliative care for children and describe choices stakeholders are forced to make.

Reviews

Write a Review

Basic Computer Science Questions & Answers

  Convert decimal mumbers into bit binary number

Convert the following decimal mumbers into 8-bit binary numbers a required for 2's complement math, and perform the indicated operations.

  Task manager to recognize and troubleshoot problems

Which system resources are probable to be at root of problem? How can you use system tools, like the Task Manager, to help recognize and troubleshoot these problems?

  Discuss strategies to dilute manager-s anger

Discuss strategies you will use to dilute this manager's anger. Discuss how you will get them both to support your recommendations.

  How to make components of system user-friendly

How do components of your computer system interact within system? What improvements or additions to your system do you think would benefit you or make system more user-friendly? Why?

  Explaining costs are classified as opex or capex

The managers of the five business units. They will need to know the following about each option in terms that nontechnical staff can readily understand: Whether the costs are classified as opex or capex.

  Determining z-transform and fourier transform

Consider the finite length sequencx(n)=D(n) + 0.5D (n-5). Determine z-transform and fourier transform of x(n). Determine N-point DFT of x(n) for N=50,10 and 5.

  Corporate agency policy on employee use of instant messaging

What specific questions should a corporate or government agency policy on "Employee use of Instant Messaging (IM) using corporate computers" address?

  Cpu-best performance improvement for least amount of money

Suppose the daytime processing load consists of 60% CPU activityand 40% disk activity. Your customers are complaining that thesystem is slow. Which would you choose to yield the best performance improvement for the least amount of money?

  Identify position-indicate what pattern is found in thread

Thread the sequence AATCGATAAGCAAAACCGGATTACGATATATAT through the tree. If any pattern is found in any position, identify that position and indicate what pattern is found.

  Descriptions of data formats and to interpret raw data

The aim of this project is to exercise and test your ability to read and understand descriptions of data formats and to interpret raw data according to a particular format.  In this exercise you will produce and read the dump of a ZIP file.

  Explain benefits of a global market

What are some of the benefits of a global market and why? List at least 2 benefits, weighing any short-term and long-term impacts.

  What strategies implement in terms of career development

What strategies you will implement in terms of your career development. How these strategies specifically relate to your career goals and advancement.

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd