Write a program that checks spelling of all words in a file

Assignment Help Basic Computer Science
Reference no: EM131318759

Write a program that checks the spelling of all words in a file. It should read each word of a file and check whether it is contained in a word list. A word list is available on most UNIX systems in the file /usr/dict/words. (If you don't have access to a UNIX system, your instructor should be able to get you a copy.) The program should print out all words that it cannot find in the word list.

Reference no: EM131318759

Questions Cloud

What access attribute should instance variables have : What access attribute should instance variables have? What access attribute should static variables have? How about static final variables?
Describe all constructors of the savings account class : Can you convert a superclass reference into a subclass reference? A subclass reference into a superclass reference? If so, give examples. If not, explain why not.
What happens if an exception does not have a matching catch : Is the type of the exception object always the same as the type declared in the catch clause that catches it?
Write a program that asks a user for a file name : Write a program that asks a user for a file name and prints the number of characters, words, and lines in that file.
Write a program that checks spelling of all words in a file : The program should print out all words that it cannot find in the word list.
Can you spot a trend in the frequencies : Modify the BabyNames.java program so that it prompts the user for a file name. The numbers in the files have comma separators, so modify the program to handle them. Can you spot a trend in the frequencies?
Prints all names that are both boy and girl names : Write a program that reads a file in the same format as babynames.txt and prints all names that are both boy and girl names (such as Alexis or Morgan).
What is the purpose of the finally clause : What happens when an exception is thrown, the code of a finally clause executes, and that code throws an exception of a different kind than the original one? Which one is caught by a surrounding catch clause? Write a sample program to try it out.
What is a checked exception : What is a checked exception? What is an unchecked exception? Is a NullPointerException checked or unchecked? Which exceptions do you need to declare with the throws reserved word?

Reviews

Write a Review

Basic Computer Science Questions & Answers

  How many unique threads are created

Consider the following code segment: pid t pid; pid = fork(); if (pid == 0) { /* child process */ fork(); thread create( . . .); } fork(); a. How many unique processes are created? b. How many unique threads are created?

  Meaning or definition of pattern matching

What is the meaning or definition of pattern matching as used in Artificial Intelligence?

  Are any main effects or two-factor interactions confounded

Construct a 27 - 2 design. Show how the design may be run in four blocks of eight observations each. Are any main effects or two-factor interactions confounded with blocks?

  Company ability to foster collaboration

1. Discuss how a company's ability to foster collaboration among its employees could help it to successfully take a planned emergence approach to strategic decision making.

  How it is used to create abstract data types

l how it is used to create abstract data types.

  What is difference between the memory bus and the pci bus

What is the difference between the memory bus and the PCI bus? Most 32-bit buses permit 16-bit reads and writes. Is there any ambiguity about where to place the data? Discuss.

  Explain how this application can be used

Explain how this application can be used to collect data from customers and employees to improve operational performance

  Write a select statement determines has any invalid values

Write a Select statement that determines whether the PaymentDate column of The Invoices table has any invalid values.

  What do you understand by the term booting

Which device can understand difference between data and programs? What do you understand by the term booting?

  Write a gui-based program that analyzes a round of golf

Write a GUI-based program that analyzes a round of golf. You will retrieve the data for 18 holes from a text file. On each line in the file will be the par for that hole (3, 4, or 5) and your core for that hole should be displayed in a label. Prov..

  Identify position-indicate what pattern is found in thread

Thread the sequence AATCGATAAGCAAAACCGGATTACGATATATAT through the tree. If any pattern is found in any position, identify that position and indicate what pattern is found.

  The design phase of the srs project is in full swing

The design phase of the SRS project is in full swing

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd