Write a perl script that count the number of letter

Assignment Help Computer Engineering

Reference no: EM132207434

Question :

Write a perl script that count the number of letter A, C, G, T/U in a genetic sequence. Sequence information in the file can be in upper or lower case.

Your script should be able to handle either. Do not include newline or carriage-return characters in any of your counts.

For example

Give the following sequence

>441E-590 Nov_16c/Nov16c/441E-590.SEQ trimmed vector-stripped GCGTCGACGTTCTACGACACGTCGTGCCCCAGGGCTCTGGCCACCATCAAGAGCGGCGTG GCGGCAGCCGTGAGCAGCGATCCCCGCATGGGCGCCTCCCTGCTCAGGCTGCACTTCCAC GACTGCTTTGTCCAAGGCTGTGACGCGTCTGTTCTTCTGTCCGGCATGGAACAAAACGCG GGCAAACAACCAAACCTTGGNCGNAACCNTGGGAACACNNANCGAACGCCCCCAAANGGC GTTTTCNGAACAAAACGGCCCTTNACTTNCAACCCAAAACCCTTCCCTTGGTCAACAAAA AAAAAANGGGGGNTTCCCCTTGGGNAACTTCGNGGAAANCCAAANGGNGGGGTTTCTTTT AAAAACAAAC
your output should look like

inventory for '441E-590' : A: 89 C: 111 G: 89 T/U: 64 other characters: 17

Reference no: EM132207434

Questions Cloud

Personal leadership vision : Please craft and post a “personal leadership vision”. Be thoughtful and think with conviction.

Write a program that allows the user to enter data into form : Write a program that allows the user to enter data into a form. The program should use character graphics and capabilities provided by the curses library.

Which ones are used more frequently than the others : There are three most important monetary tools, that is the open-market operation (i.e. buying or selling securities), setting the reserve requirement.

Four phases of emergency management : Discuss at least one important lesson learned for each of the four phases of emergency management:

Write a perl script that count the number of letter : Write a perl script that count the number of letter A, C, G, T/U in a genetic sequence. Sequence information in the file can be in upper or lower case.

Calculate the output and profits using given information : Consider the market for widgets. Widgets are homogeneous, and the estimated demand is 150- 0.1P where P is the market price in dollars and Q is the total.

Prints out the multiplication table for a range of numbers : Prints out the Multiplication Table for a range of numbers. Prompts the user for a starting number: say 'x'.

What the sited metric says about the state of the economy : Examine those two documents and indentify/explain three metrics that the Fed used to assess the economy (relative to policy-making).

The scenario constitutes violation of public policy : Explaining your conclusion regarding whether the scenario constitutes a violation of public policy or a breach of a covenant of good faith and fair dealing.

User Account

All Pages