Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
1. The following series of nucleotide bases forms part of a DNA molecule: TACTTATGACACAGGAGGACT
(a) Convert this string of bases into the bases that would be found on the corresponding mRNA molecule (transcription).
(b) Convert your answer from (a) into codons, and then list the string of amino acids that they code for (translation).
(c) Suppose that the 4th "T" on the original DNA sequence (underlined) is changed to a "G" by a point mutation. How is the resulting string of amino acids changed?
(d) Suppose that the last "G" on the original DNA sequence (underlined) is changed to a "C" by a point mutation. How is the resulting string of amino acids changed?
(e) Suppose that an extra "C" is inserted into the original DNA sequence after the 1st "C" (underlined). How is the resulting string of amino acids changed?
(f) Suppose that the 31d "A" on the original DNA sequence (underlined) is deleted. How is the resulting string of amino acids changed?
(g) Why are frameshift mutations (insertions and deletions) more likely to produce changes in an organism than a point mutation?
A patient has esophageal cancer and should have a feeding tube inserted. The nurse tells the patient that the tube will be inserted surgically into the duodenum. The wife asks why the tube will not be inserted into the stomach directly.
what are the genotypes of a male yellow rat crossed with a gray female rat producing forty-six gray and fifty- three yellow offspring? (Hint: There are three colours for rats; yellow, gray black. The yellow and black are homozygous.)
Assume n-butylmalonate is added to an aerobic suspension of kidney cells using glucose exclusively as fuel. Predict, with description, the effect of this inhibitor on.
The first experiment was a process to determine whether the seeds grew better in acidic or regular soil. Two planting containers (A and B) each with four sections were acquired.
Explain why it is important not to touch any other area of the mouth except the pharyngeal membranes when taking a throat culture.
A differs from that of the other four species because of simple misalignment, then what should the computer software find when it compares the series of Species A to those of the other four species.
A restriction endonuclease "cuts" two DNA molecules at the same location. What can you assume is identical about the molecules at that location?
What is mycolic acid? What organism produces it and where in the cell are you most likely to find it?
what makes the u.s. health care delivery system unique? what are the strengths of this vast system and what are the
Why would lowering the temperature of the medium in which cells were growing be expected to affect the ability of the cells to form gap junctions with one another?
In a cross of two pure-breeding lines of tomatoes producing different fruit sizes, the variance in grams(g) of fruit weight in the F1 is 2.10 g, and the variance among the F2 is 6.00 g.
How is the Dikaryotic life cycle of fungi similar to the Alternation of Generations seen in mosses ? How is the Dikaryotic life cycle of fungi different from the Alternation of Generations seen in mosses?
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +1-415-670-9521
Phone: +1-415-670-9521
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd