Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
1. The following series of nucleotide bases forms part of a DNA molecule: TACTTATGACACAGGAGGACT
(a) Convert this string of bases into the bases that would be found on the corresponding mRNA molecule (transcription).
(b) Convert your answer from (a) into codons, and then list the string of amino acids that they code for (translation).
(c) Suppose that the 4th "T" on the original DNA sequence (underlined) is changed to a "G" by a point mutation. How is the resulting string of amino acids changed?
(d) Suppose that the last "G" on the original DNA sequence (underlined) is changed to a "C" by a point mutation. How is the resulting string of amino acids changed?
(e) Suppose that an extra "C" is inserted into the original DNA sequence after the 1st "C" (underlined). How is the resulting string of amino acids changed?
(f) Suppose that the 31d "A" on the original DNA sequence (underlined) is deleted. How is the resulting string of amino acids changed?
(g) Why are frameshift mutations (insertions and deletions) more likely to produce changes in an organism than a point mutation?
It is a very curcial concept to understand how the immune response is mounted against viruses, bacteria, protozoans and helminthes. For an effective immune response, both innate and adaptive immunity should work together.
This Project report elaborates a critical review of important elements attached to Advanced Glycated End Products (AGEs). It is very crucial to understand the process called Millard reaction.
Soil stabilization is the permanent physical and chemical alteration of soils to enhance their physical properties. Stabilization can increase the shear strength of a soil and control the shrink-swell properties.
This assignment has three parts which contains questions related to Microbiology. It contains basic principles of microscopy, staining techniques in microbiology and microbial growth in the food industry.
Lipid metabolites are often seen as key elements in cellular signaling. Is this unique? Please provide several examples of the function of lipids as key elements in signal arrays and list the biologic functions these signals affect?
Please describe how one might search for chemical structure, biologic function relationships, involving small molecular weight lipophylic compounds. Provide one example.
Write a case study which detailing a scenario of a patient being investigated in the Haematology laboratory.
The use of PCR and genetic approaches in biotechnology
Glucose oxidase is an enzyme that can be used for measurements of glucose levels by combining this reaction with an oxygen probe.
What phenotypic ratio would you get if you crossed a white mouse and a heterozygous brown mouse?
Prepare an essay on nosocomial infection.
To increase the awareness of monitoring and recording the blood pressure of patients and practice measuring blood pressure in a safe environment.
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +1-415-670-9521
Phone: +1-415-670-9521
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd