Which of the two types evidence is more reliable

Assignment Help Accounting Basics
Reference no: EM132745176

Question: The following are eight situations, each containing two means of accumulating evidence:

1. Confirm accounts receivable with business organizations versus confirming receivables with consumers.

2. Physically examine 8 cm steel plates versus examining electronic parts.

3. Examine duplicate sales invoices when several competent people are checking one another's work versus examining documents prepared by a competent person in a oneperson staff.

4. Physically examine inventory of parts for the number of units on hand versus examining them for the likelihood of inventory being obsolete.

5. Confirm a bank balance versus confirming the oil and gas reserves with a geologist specializing in oil and gas.

6. Confirm a bank balance versus examining the client's bank statements.

7. Physically count the client's inventory held by an independent party versus confirming the count with an independent party.

8. Physically count the client's inventory versus obtaining a count from the company president.

For each of the eight situations state

• which of the two types evidence is more reliable

• which of the factors discussed in the chapter affect the appropriateness of the evidence.

Reference no: EM132745176

Questions Cloud

Create a vegetable tray for a party : What could you do if you needed to create a vegetable tray for a party but your carrots looks a little wrinkly and your celery is limp
How much does looney need to borrow in dollars today : Looney Corp. has net payables of 750,000 euros due in 270 days. The German interest rate (where Looney has operations) is 9% over the 270 day period.
How dose renewable resources help : How dose renewable resources help with climate change compared to non renewable resources?
New strand of dna that would be produced : Using the DNA strand CCTTAAGGGATCACGTGGAATCAC, reading from the left, consider the impact of the second T(thymine) is mistakenly replicated as cytosine.
Which of the two types evidence is more reliable : The following are eight situations, each containing two means of accumulating evidence: Confirm accounts receivable with business organizations versus.
Morphological types of chronic inflammation : What are the morphological types of chronic inflammation?
Compute the cost of the ordinary share of west corp : Assume that the market price of West Corp share is P40. The dividend to be paid at the end of the coming year is P4 per share; it is expected to grow.
Make a simple labelled diagram of a hypha : 1. Fungi were once placed in the same kingdom as plants. What evidence suggests that fungi are very different from plants?
Explain gas exchange in plants : Which statement is correct concerning gas exchange in plants?

Reviews

Write a Review

Accounting Basics Questions & Answers

  How much of the loss from candy apple can john deduct

John also has ordinary business income of $20,500 from Sweet Pea, How much of the loss from Candy Apple can John deduct

  Prepare je for each of the given transactions

Draw T accounts where possible/relevant. Prepare J/E for each of the transactions. Transfer the J/E to ledger accounts (make up a simple Chart of Accounts and use the numbers in the ledger Accts and J/E).

  Identify and explain the type of auditor opinion required

Assuming no amendments have been made, identify and explain the type of auditor's opinion required for each issue outlined above

  Challenges of using either of these policies

What is more effective for our economy, fiscal or monetary policy? What are the challenges of using either of these policies to help stabilize our economy?

  Calculate the npv of project

Calculate the NPV of this project. Should the company buy and install the machine press?

  Prepare statement of changes in stockholders equity

Prepare an income statement, a statement of changes in stockholders' equity, a balance sheet, and a statement of cash flows.

  Calculated the common stocks and the equity of alpha

Calculated the common stocks and the equity of Alpha if the net income at the end of the year was USD 10 million

  Prepare a partial income statement for coreaba

Assuming the Industrial Design Division qualifies for treatment as a discontinued operation, prepare a partial income statement for Coreaba for 2014

  Problem regarding the comparative balance sheets

The Turtle Corporation prepared the following comparative balance sheets at December 31, 2014 and 2013:

  Method of verifying accuracy of recorded dividend income

Jones was engaged to examine the financial statements of Gamma Corporation for the year ended June 30, 2002. Having completed an examination of the investment securities, which of the following is the best method of verifying the accuracy of recor..

  Pt angushas purchased three delivery trucks

In the recent years, PT Angushas purchased three delivery trucks. Because of frequent employee turnover in the accounting department, a different accountant was in charge of selecting the depreciation method of each delivery truck, and various met..

  Financial statements for a pension trust fund

The principal and earnings of a gift held in a trust that can be spent for the college education of the children of deceased policemen should be accounted.

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd