Which of the two types evidence is more reliable

Assignment Help Accounting Basics
Reference no: EM132745176

Question: The following are eight situations, each containing two means of accumulating evidence:

1. Confirm accounts receivable with business organizations versus confirming receivables with consumers.

2. Physically examine 8 cm steel plates versus examining electronic parts.

3. Examine duplicate sales invoices when several competent people are checking one another's work versus examining documents prepared by a competent person in a oneperson staff.

4. Physically examine inventory of parts for the number of units on hand versus examining them for the likelihood of inventory being obsolete.

5. Confirm a bank balance versus confirming the oil and gas reserves with a geologist specializing in oil and gas.

6. Confirm a bank balance versus examining the client's bank statements.

7. Physically count the client's inventory held by an independent party versus confirming the count with an independent party.

8. Physically count the client's inventory versus obtaining a count from the company president.

For each of the eight situations state

• which of the two types evidence is more reliable

• which of the factors discussed in the chapter affect the appropriateness of the evidence.

Reference no: EM132745176

Questions Cloud

Create a vegetable tray for a party : What could you do if you needed to create a vegetable tray for a party but your carrots looks a little wrinkly and your celery is limp
How much does looney need to borrow in dollars today : Looney Corp. has net payables of 750,000 euros due in 270 days. The German interest rate (where Looney has operations) is 9% over the 270 day period.
How dose renewable resources help : How dose renewable resources help with climate change compared to non renewable resources?
New strand of dna that would be produced : Using the DNA strand CCTTAAGGGATCACGTGGAATCAC, reading from the left, consider the impact of the second T(thymine) is mistakenly replicated as cytosine.
Which of the two types evidence is more reliable : The following are eight situations, each containing two means of accumulating evidence: Confirm accounts receivable with business organizations versus.
Morphological types of chronic inflammation : What are the morphological types of chronic inflammation?
Compute the cost of the ordinary share of west corp : Assume that the market price of West Corp share is P40. The dividend to be paid at the end of the coming year is P4 per share; it is expected to grow.
Make a simple labelled diagram of a hypha : 1. Fungi were once placed in the same kingdom as plants. What evidence suggests that fungi are very different from plants?
Explain gas exchange in plants : Which statement is correct concerning gas exchange in plants?

Reviews

Write a Review

Accounting Basics Questions & Answers

  How much control does fed have over this longer real rate

Hubbard argues that the Fed can control the Fed funds rate, but the interest rate that is important for the economy is a longer-term real rate of interest.   How much control does the Fed have over this longer real rate?

  Coures:- fundamental accounting principles

Coures:- Fundamental Accounting Principles: - Explain the goals and uses of special journals.

  Accounting problems

Accounting problems,  Draw a detailed timeline incorporating the dividends, calculate    the exact Payback Period  b)   the discounted Payback Period. the IRR,  the NPV, the Profitability Index.

  Write a report on internal controls

Write a report on Internal Controls

  Prepare the bank reconciliation for company

Prepare the bank reconciliation for company.

  Cost-benefit analysis

Create a cost-benefit analysis to evaluate the project

  Theory of interest

Theory of Interest: NPV, IRR, Nominal and Real, Amortization, Sinking Fund, TWRR, DWRR

  Liquidity and profitability

Distinguish between liquidity and profitability.

  What is the expected risk premium on the portfolio

Your Corp, Inc. has a corporate tax rate of 35%. Please calculate their after tax cost of debt expressed as a percentage. Your Corp, Inc. has several outstanding bond issues all of which require semiannual interest payments.

  Simple interest and compound interest

Simple Interest, Compound interest, discount rate, force of interest, AV, PV

  Capm and venture capital

CAPM and Venture Capital

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd