What secondary structure is typically bound

Reference no: EM133208930

Question: What secondary structure is typically bound by the translocon during co-translational transport but is not cleaved by a signal peptidase and is deposited into the hydrophobic region of membrane?

1. beta-sheet

2. N- terminal hydrophobic signal sequences

3. alpha helices

4. glycolipids

Reference no: EM133208930

Questions Cloud

What is speciation : What is speciation- A new plant or animal species is developed through speciation. When a group within a species separates from other members of its species

How does chronic hypoxemia lead to polycthemia : How does chronic hypoxemia lead to polycthemia and What effects do hypoxic vasoconstriction and polycythemia have on the circulatory system

How many cells were plated on all 4 plates : How many cells were plated on all 4 plates? How many colonies total? Thus how many DNA molecules were able to transform those cells

Write a set of at least four ethical behaviours : Write a set of at least four ethical behaviours that you intend to abide by in your work as a real estate agent, based on your knowledge

What secondary structure is typically bound : What secondary structure is typically bound by the translocon during co-translational transport but is not cleaved by a signal peptidase

Discuss whether the decision to build the factory : Discuss whether the decision to build the factory at Kampung Melur is considered as ethical or unethical by applying Utilitarianism and Kantian Theory

Explain the evidence for evolution : Explain the evidence for evolution? What evidence did Darwin use to explain his theory of evolution? What do we know today that we didn't know then

Discuss the main dimensions for classification : Discuss the main dimensions for classification of networked e-business. Discuss the main business directions and operations related to networked e-business

What amino acid sequence will be generated : What amino acid sequence will be generated based on this strand of DNA? Use Figure 16.6 in your text book 3TACCGCTTACTGAAAGTTATT

User Account

All Pages