What is the total magnification of an image

Assignment Help Science

Reference no: EM131080926

1. Using the figure below, which of the cells is gram positive and which is gram negative? How do you know?

2. Using the figure above, what other phenotypes can you use to characterize the sample on the right?

3. You have used a compound microscope to observe your cells. What is the total magnification of an image if it was viewed using a 10X ocular lens and a 40X objective lens?

4. Next week, you will extract DNA from your chosen microbe. Read the protocol carefully. Step 12 instructs you to add isopropanol, and then centrifuge. After centrifuging the tube, where is the DNA in the supernatant or in the pellet)? Why?

5. Once you have purified your DNA, you will perform PCR. Answer each of the following questions:

a. You will be amplifying the 16S rDNA locus. What are two features of this locus that make it valuable for identifying an uncultureable microbe?

b. If your DNA is at a concentration of 48 ng/ul and you wish to add 100ng of template to your PCR reaction, how many microliters of DNA will you add?

c. If your initial sample contains 3 copies of the 16S rDNA region, how many copies will there be after 30 PCR cycles?

6. On day 3, you will perform an agarose gel. You will load a portion of your PCR reaction on the gel.

a. How many bands do you expect to see per lane?

b. What size do you expect the band s) will be?

7. On Day 4, you will obtain your sequence. An old technology would run chain-terminated products on a polyacrylamide gel to identify the fragments. On the figure below, draw the gel that would result from the following template sequence make sure to pay attention to the 5' and 3' ends. Remember how DNA synthesis works!):

3' - ATGGCTGAGGTCTGAAATGTC - 5'

Reference no: EM131080926

Questions Cloud

Explain the major contribution of mother teresa : explain the major contribution of Mother Teresa. Submit a 3-5 page essay in which you explain the major contribution(s) that your historical character made on American religious history.

Using leadership to improve ethical performance : At this point, you should have identified the leader you would like to interview. You should also have already contacted him / her and have scheduled an interview time / date. If not, do it as soon as possible.

Find the exact solution of the initial-value problem : Find the exact solution of the initial-value problem,

How would you define the status of religion in america today : How would you define the status of religion in America today? Are we still 'one nation, under God' or a nation that has lost its religious moorings? Discuss.

What is the total magnification of an image : You have used a compound microscope to observe your cells. What is the total magnification of an image if it was viewed using a 10X ocular lens and a 40X objective lens

Leading producers of telecommunication products : DataCom Inc. is one of the leading producers of telecommunication products located in the Pacific Northwest. It has more than 1,000 sales representatives in North America. They call orders into the central office where office workers using the centra..

Search engines used for this is google scholar : It should be strictly based on Australian Background not any other background. it should not be a statistical literature review it should be done in social work perspectivethere should be minimum 20 references.

Rental place charges a flat rate : A car rental place charges a flat rate of $60 to rent a car plus 10 cents a mile. Write the amount charged as a function of how many miles the car is driven.

What was the original goal of the fourth crusade : What was the original goal of the Fourth Crusade? What happened to derail this original design and what was the outcome of the Fourth Crusade? What were the long-term consequences of the Fourth Crusade?

User Account

All Pages